Home      Discussion      Topics      Dictionary      Almanac
Signup       Login
Telomere

Telomere

Discussion
Ask a question about 'Telomere'
Start a new discussion about 'Telomere'
Answer questions from other users
Full Discussion Forum
 
Encyclopedia

A telomere is a region of repetitive DNA
DNA
Deoxyribonucleic acid is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms . The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in...

 sequences at the end of a chromosome
Chromosome
A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...

, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (τέλος) "end" and merοs (μέρος, root: μερ-) "part". The telomere regions deter the degradation of genes
Gênes
Gênes is the name of a département of the First French Empire in present Italy, named after the city of Genoa. It was formed in 1805, when Napoleon Bonaparte occupied the Republic of Genoa. Its capital was Genoa, and it was divided in the arrondissements of Genoa, Bobbio, Novi Ligure, Tortona and...

 near the ends of chromosomes by allowing for the shortening of chromosome ends, which necessarily occurs during chromosome replication. Over time, due to each cell division, the telomere ends do become shorter.

During cell division
Cell division
Cell division is the process by which a parent cell divides into two or more daughter cells . Cell division is usually a small segment of a larger cell cycle. This type of cell division in eukaryotes is known as mitosis, and leaves the daughter cell capable of dividing again. The corresponding sort...

, enzymes that duplicate DNA cannot continue their duplication all the way to the end of chromosomes. If cells divided without telomeres, they would lose the ends of their chromosomes, and the necessary information they contain. The telomeres are disposable buffers blocking the ends of the chromosomes, are consumed during cell division, and are replenished by an enzyme, telomerase reverse transcriptase
Telomerase reverse transcriptase
Telomerase reverse transcriptase is a catalytic subunit of the enzyme telomerase. Its absence is associated with the disorder Cri du chat....

.

Discovery


In the early 1970s, Russian theorist Alexei Olovnikov first recognized the problem of how chromosomes could not completely replicate their ends. Building on this, and to accommodate Leonard Hayflick
Leonard Hayflick
Leonard Hayflick , Ph.D., is Professor of Anatomy at the University of California, San Francisco, School of Medicine, and was Professor of Medical Microbiology at Stanford University School of Medicine. He is a past president of the Gerontological Society of America and was a founding member of the...

's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell/DNA replicates until the loss reaches a critical level, at which point cell division ends.

In 1975–1977, Elizabeth Blackburn
Elizabeth Blackburn
Elizabeth Helen Blackburn, AC, FRS is an Australian-born American biological researcher at the University of California, San Francisco, who studies the telomere, a structure at the end of chromosomes that protects the chromosome. Blackburn co-discovered telomerase, the enzyme that replenishes the...

, working as a postdoctoral fellow at Yale University with Joseph Gall
Joseph G. Gall
Joseph Grafton Gall is an American cell biologist and winner of the 2006 Albert Lasker Special Achievement Award. He also won the 2007 Louisa Gross Horwitz Prize...

, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Their work was published in 1978.
The telomere shortening mechanism normally limits cells to a fixed number of divisions, and animal studies suggest that this is responsible for aging on the cellular level and sets a limit on lifespans. Telomeres protect a cell's chromosomes from fusing with each other or rearranging — abnormalities that can lead to cancer
Cancer
Cancer , known medically as a malignant neoplasm, is a large group of different diseases, all involving unregulated cell growth. In cancer, cells divide and grow uncontrollably, forming malignant tumors, and invade nearby parts of the body. The cancer may also spread to more distant parts of the...

 — and so cells are destroyed when their telomeres are consumed. Most cancers are the result of "immortal" cells that have ways of evading this programmed destruction.

Elizabeth Blackburn
Elizabeth Blackburn
Elizabeth Helen Blackburn, AC, FRS is an Australian-born American biological researcher at the University of California, San Francisco, who studies the telomere, a structure at the end of chromosomes that protects the chromosome. Blackburn co-discovered telomerase, the enzyme that replenishes the...

, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize
Nobel Prize
The Nobel Prizes are annual international awards bestowed by Scandinavian committees in recognition of cultural and scientific advances. The will of the Swedish chemist Alfred Nobel, the inventor of dynamite, established the prizes in 1895...

 in Physiology or Medicine
Nobel Prize in Physiology or Medicine
The Nobel Prize in Physiology or Medicine administered by the Nobel Foundation, is awarded once a year for outstanding discoveries in the field of life science and medicine. It is one of five Nobel Prizes established in 1895 by Swedish chemist Alfred Nobel, the inventor of dynamite, in his will...

 for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.

Structure, function and evolutionary biology


Telomeres are repetitive DNA sequences located at the termini of linear chromosomes of most eukaryotic
Eukaryote
A eukaryote is an organism whose cells contain complex structures enclosed within membranes. Eukaryotes may more formally be referred to as the taxon Eukarya or Eukaryota. The defining membrane-bound structure that sets eukaryotic cells apart from prokaryotic cells is the nucleus, or nuclear...

 organisms. Most prokaryote
Prokaryote
The prokaryotes are a group of organisms that lack a cell nucleus , or any other membrane-bound organelles. The organisms that have a cell nucleus are called eukaryotes. Most prokaryotes are unicellular, but a few such as myxobacteria have multicellular stages in their life cycles...

s, lacking this linear arrangement, do not have telomeres. Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. The protection against homologous recombination
Homologous recombination
Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA. It is most widely used by cells to accurately repair harmful breaks that occur on both strands of DNA, known as double-strand breaks...

 (HR) and non-homologous end joining
Non-homologous end joining
Non-homologous end joining is a pathway that repairs double-strand breaks in DNA. NHEJ is referred to as "non-homologous" because the break ends are directly ligated without the need for a homologous template, in contrast to homologous recombination, which requires a homologous sequence to guide...

 (NHEJ) constitutes the essential “capping” role of telomeres that distinguishes them from DNA double-strand breaks (DSBs).
In most prokaryotes, chromosomes are circular and, thus, do not have ends to suffer premature replication
DNA replication
DNA replication is a biological process that occurs in all living organisms and copies their DNA; it is the basis for biological inheritance. The process starts with one double-stranded DNA molecule and produces two identical copies of the molecule...

 termination. A small fraction of bacteria
Bacteria
Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...

l chromosomes (such as those in Streptomyces
Streptomyces
Streptomyces is the largest genus of Actinobacteria and the type genus of the family Streptomycetaceae. Over 500 species of Streptomyces bacteria have been described. As with the other Actinobacteria, streptomycetes are gram-positive, and have genomes with high guanine and cytosine content...

 and Borrelia
Borrelia
Borrelia is a genus of bacteria of the spirochete phylum. It causes borreliosis, a zoonotic, vector-borne disease transmitted primarily by ticks and some by lice, depending on the species...

) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.

While replicating of DNA, the eukaryotic DNA replication enzymes (the DNA polymerase protein complex) cannot replicate the sequences present at the ends of the chromosomes (or more precisely the chromatid fibres). Hence, these sequences and the information they carry may get lost. This is the reason why telomeres are so important in context of successful cell division: They "cap" the end-sequences and themselves get lost in the process of DNA replication. But the cell has an enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase, thus, "replenishes" the telomere "cap" of the DNA. In most multicellular eukaryotic organisms, telomerase is active only in germ cell
Germ cell
A germ cell is any biological cell that gives rise to the gametes of an organism that reproduces sexually. In many animals, the germ cells originate near the gut of an embryo and migrate to the developing gonads. There, they undergo cell division of two types, mitosis and meiosis, followed by...

s, stem cell
Stem cell
This article is about the cell type. For the medical therapy, see Stem Cell TreatmentsStem cells are biological cells found in all multicellular organisms, that can divide and differentiate into diverse specialized cell types and can self-renew to produce more stem cells...

s, and certain white blood cell
White blood cell
White blood cells, or leukocytes , are cells of the immune system involved in defending the body against both infectious disease and foreign materials. Five different and diverse types of leukocytes exist, but they are all produced and derived from a multipotent cell in the bone marrow known as a...

s. There are theories that claim that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence
Senescence
Senescence or biological aging is the change in the biology of an organism as it ages after its maturity. Such changes range from those affecting its cells and their function to those affecting the whole organism...

 and in the prevention of cancer
Cancer
Cancer , known medically as a malignant neoplasm, is a large group of different diseases, all involving unregulated cell growth. In cancer, cells divide and grow uncontrollably, forming malignant tumors, and invade nearby parts of the body. The cancer may also spread to more distant parts of the...

. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

Telomere length varies greatly between species, from approximately 300 base pair
Base pair
In molecular biology and genetics, the linking between two nitrogenous bases on opposite complementary DNA or certain types of RNA strands that are connected via hydrogen bonds is called a base pair...

s in yeast to many kilobases in humans, and usually is composed of arrays of guanine
Guanine
Guanine is one of the four main nucleobases found in the nucleic acids DNA and RNA, the others being adenine, cytosine, and thymine . In DNA, guanine is paired with cytosine. With the formula C5H5N5O, guanine is a derivative of purine, consisting of a fused pyrimidine-imidazole ring system with...

-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle stabilized by telomere-binding proteins. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.

Telomere shortening in humans can induce replicative senescence, which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. However, shortened telomeres impair immune function that might also increase cancer susceptibility. Malignant cells that bypass this arrest become immortalized by telomere extension due mostly to the activation of telomerase, the reverse transcriptase enzyme responsible for synthesis of telomeres. However, 5–10% of human cancers activate the Alternative Lengthening of Telomeres (ALT) pathway, which relies on recombination-mediated elongation.

Since shorter telomeres are thought to be a cause of poorer health and aging, this raises the question of why longer telomeres are not selected for to ameliorate these effects. A prominent explanation suggests that inheriting longer telomeres would cause increased cancer rates (e.g. Weinstein and Ciszek, 2002). However, a recent literature review and analysis suggests this is unlikely, because shorter telomeres and telomerase
Telomerase
Telomerase is an enzyme that adds DNA sequence repeats to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. This region of repeated nucleotide called telomeres contains non-coding DNA material and prevents constant loss of important DNA from...

 inactivation is more often associated with increased cancer rates, and the mortality from cancer occurs late in life when the force of natural selection
Natural selection
Natural selection is the nonrandom process by which biologic traits become either more or less common in a population as a function of differential reproduction of their bearers. It is a key mechanism of evolution....

 is very low. An alternative explanation to the hypothesis that long telomeres are selected against due to their cancer promoting effects is the "thrifty telomere" hypothesis that suggests that the cellular proliferation effects of longer telomeres causes increased energy expenditures. In environments of energetic limitation, shorter telomeres might be an energy sparing mechanism.

Human telomeres, cancer and ALT (Alternative lengthening of telomeres)



Human somatic cells without telomerase gradually lose telomeric sequences as a result of incomplete replication (Counter et al., 1992). As human telomeres grow shorter, eventually cells reach the limit of their replicative capacity and progress into senescence or old age. Senescence involves p53 and pRb pathways and leads to the halting of cell proliferation
Cell growth
The term cell growth is used in the contexts of cell development and cell division . When used in the context of cell division, it refers to growth of cell populations, where one cell grows and divides to produce two "daughter cells"...

 (Campisi, 2005). Senescence may play an important role in suppression of cancer emergence, although inheriting shorter telomeres probably does not protect against cancer. With critically shortened telomeres, further cell proliferation can be achieved by inactivation of p53 and pRb pathways. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability
Genome instability
Usually, all cells in an individual in a given species show a constant number of chromosomes, which constitute what is known as the karyotype defining this species , although some species present a very high karyotypic variability.Sometimes, in a species with a stable karyotype, random variations...

, and almost all cells die. Rare cells emerge from crisis immortalized through telomere lengthening by either activated telomerase or ALT (Colgina and Reddel, 1999; Reddel and Bryan, 2003). The first description of an ALT cell line demonstrated that their telomeres are highly heterogeneous in length and predicted a mechanism involving recombination (Murnane et al., 1994). Subsequent studies have confirmed a role for recombination in telomere maintenance by ALT (Dunham et al., 2000), however the exact mechanism of this pathway is yet to be determined. ALT cells produce abundant t-circles, possible products of intratelomeric recombination and t-loop resolution (Tomaska et al., 2000; 2009; Cesare and Griffith, 2004; Wang et al., 2004).

Telomerase
Telomerase
Telomerase is an enzyme that adds DNA sequence repeats to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. This region of repeated nucleotide called telomeres contains non-coding DNA material and prevents constant loss of important DNA from...

 is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence that acts to protect the terminal ends of chromosomes. The actions of telomerase are necessary because, during replication, DNA polymerase
DNA polymerase
A DNA polymerase is an enzyme that helps catalyze in the polymerization of deoxyribonucleotides into a DNA strand. DNA polymerases are best known for their feedback role in DNA replication, in which the polymerase "reads" an intact DNA strand as a template and uses it to synthesize the new strand....

 can synthesize DNA in only a 5' to 3' direction and can do so only by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. This replacement of the RNA primers is not a problem at origins of replication within the chromosome because DNA polymerase can use a previous stretch of DNA 5' to the RNA template as a template to backfill the sequence where the RNA primer was; at the terminal end of the chromosome, however, DNA polymerase cannot replace the RNA primer because there is no position 5' of the RNA primer where another primer can be placed, nor is there DNA upstream that can be used as a primer so that DNA polymerase can replace the RNA primer. Without telomeres at the end of DNA, this genetic sequence at the end of the chromosome would be deleted. The chromosome would grow shorter and shorter in subsequent replications and genetic information would be lost. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double-strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerase
Telomerase
Telomerase is an enzyme that adds DNA sequence repeats to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. This region of repeated nucleotide called telomeres contains non-coding DNA material and prevents constant loss of important DNA from...

s, part of a protein subgroup of specialized reverse transcriptase
Reverse transcriptase
In the fields of molecular biology and biochemistry, a reverse transcriptase, also known as RNA-dependent DNA polymerase, is a DNA polymerase enzyme that transcribes single-stranded RNA into single-stranded DNA. It also helps in the formation of a double helix DNA once the RNA has been reverse...

 enzymes known as TERT
Telomerase reverse transcriptase
Telomerase reverse transcriptase is a catalytic subunit of the enzyme telomerase. Its absence is associated with the disorder Cri du chat....

 (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms, oxidative stress, and, because TERT expression is very low in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides, although, in other cellular compartments that require extensive cell division, such as stem cell
Stem cell
This article is about the cell type. For the medical therapy, see Stem Cell TreatmentsStem cells are biological cells found in all multicellular organisms, that can divide and differentiate into diverse specialized cell types and can self-renew to produce more stem cells...

s and certain white blood cell
White blood cell
White blood cells, or leukocytes , are cells of the immune system involved in defending the body against both infectious disease and foreign materials. Five different and diverse types of leukocytes exist, but they are all produced and derived from a multipotent cell in the bone marrow known as a...

s, TERT is expressed at higher levels and telomere shortening is partially or fully prevented.

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In human
Human
Humans are the only living species in the Homo genus...

s, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but, in general, one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures (G-quadruplex
G-quadruplex
In molecular biology, G-quadruplexes are nucleic acid sequences that are rich in guanine and are capable of forming a four-stranded structure...

es), with sets of four bases held in plane and then stacked on top of each other with either a sodium or a potassium ion between the planar quadruplexes.

If telomeres become too short, they have the potential to unfold from their presumed closed structure. The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age (senescence
Senescence
Senescence or biological aging is the change in the biology of an organism as it ages after its maturity. Such changes range from those affecting its cells and their function to those affecting the whole organism...

), or begin programmed cell self-destruction (apoptosis
Apoptosis
Apoptosis is the process of programmed cell death that may occur in multicellular organisms. Biochemical events lead to characteristic cell changes and death. These changes include blebbing, cell shrinkage, nuclear fragmentation, chromatin condensation, and chromosomal DNA fragmentation...

) depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

At the very distal end of the telomere is a 300 bp single-stranded portion, which forms the T-Loop. This loop is analogous to a knot, which stabilizes the telomere, preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins, the most notable ones being TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex.

Telomere shortening



Telomeres shorten in part because of the end replication problem that is exhibited during DNA replication in eukaryote
Eukaryote
A eukaryote is an organism whose cells contain complex structures enclosed within membranes. Eukaryotes may more formally be referred to as the taxon Eukarya or Eukaryota. The defining membrane-bound structure that sets eukaryotic cells apart from prokaryotic cells is the nucleus, or nuclear...

s only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all known DNA polymerase
DNA polymerase
A DNA polymerase is an enzyme that helps catalyze in the polymerization of deoxyribonucleotides into a DNA strand. DNA polymerases are best known for their feedback role in DNA replication, in which the polymerase "reads" an intact DNA strand as a template and uses it to synthesize the new strand....

s move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA
RNA
Ribonucleic acid , or RNA, is one of the three major macromolecules that are essential for all known forms of life....

 acting as primer
Primer (molecular biology)
A primer is a strand of nucleic acid that serves as a starting point for DNA synthesis. They are required for DNA replication because the enzymes that catalyze this process, DNA polymerases, can only add new nucleotides to an existing strand of DNA...

s attach to the lagging strand a short distance ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragment
Okazaki fragment
Okazaki fragments are short molecules of single-stranded DNA that are formed on the lagging strand during DNA replication. They are between 1,000 to 2,000 nucleotides long in Escherichia coli and are between 100 to 200 nucleotides long in eukaryotes....

s. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease, and DNA ligase
DNA ligase
In molecular biology, DNA ligase is a specific type of enzyme, a ligase, that repairs single-stranded discontinuities in double stranded DNA molecules, in simple words strands that have double-strand break . Purified DNA ligase is used in gene cloning to join DNA molecules together...

 come along to convert the RNA (of the primers) to DNA and to seal the gaps in between the Okazaki fragments. But, in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it does not happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade any RNA left on the DNA. Thus, a section of the telomere is lost during each cycle of replication at the 5' end of the lagging strand.

However, in vitro studies (von Zglinicki et al. 1995, 2000) have shown that telomeres are highly susceptible to oxidative stress. Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem (ca. 20 bp) and actual telomere shortening rates (50-100 bp), and has a greater absolute impact on telomere length than shortening caused by the end-replication problem.

Lengthening telomeres


The phenomenon of limited cellular division was first observed by Leonard Hayflick
Leonard Hayflick
Leonard Hayflick , Ph.D., is Professor of Anatomy at the University of California, San Francisco, School of Medicine, and was Professor of Medical Microbiology at Stanford University School of Medicine. He is a past president of the Gerontological Society of America and was a founding member of the...

, and is now referred to as the Hayflick Limit
Hayflick limit
The Hayflick limit is the number of times a normal cell population will divide before it stops, presumably because the telomeres reach a critical length....

. Significant discoveries were made by the team led by Professor Elizabeth Blackburn
Elizabeth Blackburn
Elizabeth Helen Blackburn, AC, FRS is an Australian-born American biological researcher at the University of California, San Francisco, who studies the telomere, a structure at the end of chromosomes that protects the chromosome. Blackburn co-discovered telomerase, the enzyme that replenishes the...

 at the University of California, San Francisco
University of California, San Francisco
The University of California, San Francisco is one of the world's leading centers of health sciences research, patient care, and education. UCSF's medical, pharmacy, dentistry, nursing, and graduate schools are among the top health science professional schools in the world...

 (UCSF).

Advocates of human life extension
Life extension
Life extension science, also known as anti-aging medicine, experimental gerontology, and biomedical gerontology, is the study of slowing down or reversing the processes of aging to extend both the maximum and average lifespan...

 promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy
Gene therapy
Gene therapy is the insertion, alteration, or removal of genes within an individual's cells and biological tissues to treat disease. It is a technique for correcting defective genes that are responsible for disease development...

. They reason that this would extend human life because it would extend the Hayflick Limit. So far these ideas have not been proven in humans, but it has been demonstrated that telomere extension has successfully reversed some signs of aging in laboratory mice and the nematode
Nematode
The nematodes or roundworms are the most diverse phylum of pseudocoelomates, and one of the most diverse of all animals. Nematode species are very difficult to distinguish; over 28,000 have been described, of which over 16,000 are parasitic. It has been estimated that the total number of nematode...

 worm species Caenorhabditis elegans
Caenorhabditis elegans
Caenorhabditis elegans is a free-living, transparent nematode , about 1 mm in length, which lives in temperate soil environments. Research into the molecular and developmental biology of C. elegans was begun in 1974 by Sydney Brenner and it has since been used extensively as a model...

. However, it has been hypothesized that longer telomeres and especially telomerase activation might cause increased cancer (e.g. Weinstein and Ciszek, 2002). However, longer telomeres might also protect against cancer, because short telomeres are associated with cancer. It has also been suggested that longer telomeres might cause increased energy consumption.

Techniques to extend telomeres could be useful for tissue engineering
Tissue engineering
Tissue engineering is the use of a combination of cells, engineering and materials methods, and suitable biochemical and physio-chemical factors to improve or replace biological functions...

, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabird
Seabird
Seabirds are birds that have adapted to life within the marine environment. While seabirds vary greatly in lifestyle, behaviour and physiology, they often exhibit striking convergent evolution, as the same environmental problems and feeding niches have resulted in similar adaptations...

s. In 2003, scientists observed that the telomeres of Leach's Storm-petrel
Leach's Storm-petrel
The Leach's Storm Petrel or Leach's Petrel is a small seabird of the tubenose family. It is named after the British zoologist William Elford Leach....

 (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. In 2006, Juola et al. reported that in another unrelated, long-lived seabird species, the Great Frigatebird
Great Frigatebird
The Great Frigatebird is a large dispersive seabird in the frigatebird family. Major nesting populations are found in the Pacific and Indian Oceans, as well as a population in the South Atlantic....

 (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebird
Frigatebird
The frigatebirds are a family, Fregatidae, of seabirds. There are five species in the single genus Fregata. They are also sometimes called Man of War birds or Pirate birds. Since they are related to the pelicans, the term "frigate pelican" is also a name applied to them...

s and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

The telomere length varies in cloned animals. Sometimes the clones end up with shorter telomeres since the DNA has already divided countless times. Occasionally, the telomeres in a clone's DNA are longer because they get "reprogrammed" .

Telomere sequences


Known, up-to-date telomere sequences are listed in TelomereDB website.
Some known telomere sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrate
Vertebrate
Vertebrates are animals that are members of the subphylum Vertebrata . Vertebrates are the largest group of chordates, with currently about 58,000 species described. Vertebrates include the jawless fishes, bony fishes, sharks and rays, amphibians, reptiles, mammals, and birds...

s
Human
Human
Humans are the only living species in the Homo genus...

, mouse, Xenopus
TTAGGG
Filamentous fungi
Fungus
A fungus is a member of a large group of eukaryotic organisms that includes microorganisms such as yeasts and molds , as well as the more familiar mushrooms. These organisms are classified as a kingdom, Fungi, which is separate from plants, animals, and bacteria...

Neurospora crassa
Neurospora crassa
Neurospora crassa is a type of red bread mold of the phylum Ascomycota. The genus name, meaning "nerve spore" refers to the characteristic striations on the spores. The first published account of this fungus was from an infestation of French bakeries in 1843. N...

TTAGGG
Slime mould
Slime mould
Slime mold or mould is a broad term describing protists that use spores to reproduce. Slime molds were formerly classified as fungi, but are no longer considered part of this kingdom....

s
Physarum
Physarum
Physarum is a genus of slime molds containing the following species:*Physarum albescens*Physarum album*Physarum bivalve*Physarum bogoriense*Physarum cinereum*Physarum compressum*Physarum confertum...

, Didymium
TTAGGG
Dictyostelium
Dictyostelid
The dictyostelids are a group of cellular slime molds, or social amoebae.-Slug behavior:When food is readily available they are individual amoebae, which feed and divide normally...

AG(1-8)
Kinetoplastid
Kinetoplastid
The kinetoplastids are a group of single-cell flagellate protozoa, including a number of parasites responsible for serious diseases in humans and other animals, as well as various forms found in soil and aquatic environments...

 protozoa
Trypanosoma
Trypanosoma
Trypanosoma is a genus of kinetoplastids , a monophyletic group of unicellular parasitic flagellate protozoa. The name is derived from the Greek trypano and soma because of their corkscrew-like motion. All trypanosomes are heteroxenous and are transmitted via a vector...

, Crithidia
Crithidia
Crithidia are members of the trypanosome protozoa. They are parasites that exclusively parasitise arthropods, mainly insects. They pass from host to host as cysts in infective faeces and typically, the parasites develop in the digestive tracts of insects and interact with the intestinal epithelium...

TTAGGG
Ciliate
Ciliate
The ciliates are a group of protozoans characterized by the presence of hair-like organelles called cilia, which are identical in structure to flagella but typically shorter and present in much larger numbers with a different undulating pattern than flagella...

 protozoa
Tetrahymena
Tetrahymena
Tetrahymena are free-living ciliate protozoa that can also switch from commensalistic to pathogenic modes of survival. They are common in fresh-water. Tetrahymena species used as model organisms in biomedical research are T. thermophila and T. pyriformis.- T...

, Glaucoma
TTGGGG
Paramecium
Paramecium
Paramecium is a group of unicellular ciliate protozoa, which are commonly studied as a representative of the ciliate group, and range from about 0.05 to 0.35 mm in length. Simple cilia cover the body, which allow the cell to move with a synchronous motion at speeds of approximately 12 body...

TTGGG(T/G)
Oxytricha, Stylonychia
Stylonychia
Stylonychia is a genus of ciliate, included among the stichotrichs. It is very common in fresh water and soil, found on filamentous algae, surface films, and among particles of sediment. They can also be found swimming on/through decaying vegetation and pond scum floating through the water...

, Euplotes
TTTTGGGG
Apicomplexa
Apicomplexa
The Apicomplexa are a large group of protists, most of which possess a unique organelle called apicoplast and an apical complex structure involved in penetrating a host's cell. They are unicellular, spore-forming, and exclusively parasites of animals. Motile structures such as flagella or...

n protozoa
Plasmodium
Plasmodium
Plasmodium is a genus of parasitic protists. Infection by these organisms is known as malaria. The genus Plasmodium was described in 1885 by Ettore Marchiafava and Angelo Celli. Currently over 200 species of this genus are recognized and new species continue to be described.Of the over 200 known...

TTAGGG(T/C)
Higher plant
Plant
Plants are living organisms belonging to the kingdom Plantae. Precise definitions of the kingdom vary, but as the term is used here, plants include familiar organisms such as trees, flowers, herbs, bushes, grasses, vines, ferns, mosses, and green algae. The group is also called green plants or...

s
Arabidopsis thaliana
Arabidopsis thaliana
Arabidopsis thaliana is a small flowering plant native to Europe, Asia, and northwestern Africa. A spring annual with a relatively short life cycle, arabidopsis is popular as a model organism in plant biology and genetics...

TTTAGGG
Green algae Chlamydomonas
Chlamydomonas
Chlamydomonas is a genus of green algae. They are unicellular flagellates. Chlamydomonas is used as a model organism for molecular biology, especially studies of flagellar motility and chloroplast dynamics, biogenesis, and genetics...

TTTTAGGG
Insect
Insect
Insects are a class of living creatures within the arthropods that have a chitinous exoskeleton, a three-part body , three pairs of jointed legs, compound eyes, and two antennae...

s
Bombyx mori
Bombyx mori
The silkworm is the larva or caterpillar of the domesticated silkmoth, Bombyx mori . It is an economically important insect, being a primary producer of silk...

TTAGG
Roundworms Ascaris lumbricoides
Ascaris lumbricoides
Ascaris lumbricoides is the giant roundworm of humans, belonging to the phylum Nematoda. An ascarid nematode, it is responsible for the disease ascariasis in humans, and it is the largest and most common parasitic worm in humans. One-sixth of the human population is estimated to be infected by this...

TTAGGC
Fission yeast
Yeast
Yeasts are eukaryotic micro-organisms classified in the kingdom Fungi, with 1,500 species currently described estimated to be only 1% of all fungal species. Most reproduce asexually by mitosis, and many do so by an asymmetric division process called budding...

s
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Schizosaccharomyces pombe, also called "fission yeast", is a species of yeast. It is used as a model organism in molecular and cell biology. It is a unicellular eukaryote, whose cells are rod-shaped. Cells typically measure 3 to 4 micrometres in diameter and 7 to 14 micrometres in length...

TTAC(A)(C)G(1-8)
Budding yeast
Yeast
Yeasts are eukaryotic micro-organisms classified in the kingdom Fungi, with 1,500 species currently described estimated to be only 1% of all fungal species. Most reproduce asexually by mitosis, and many do so by an asymmetric division process called budding...

s
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...

TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata
Candida glabrata
Candida glabrata is a haploid yeast of the genus Candida, previously known as Torulopsis glabrata. This species of yeast is non-dimorphic and no mating activity has been observed. Until recently, C. glabrata was thought to be a primarily non-pathogenic organism. However, with the ever increasing...

GGGGTCTGGGTGCTG
Candida albicans
Candida albicans
Candida albicans is a diploid fungus that grows both as yeast and filamentous cells and a causal agent of opportunistic oral and genital infections in humans. Systemic fungal infections including those by C...

GGTGTACGGATGTCTAACTTCTT
Candida tropicalis
Candida tropicalis
Candida tropicalis is a species of yeast in the genus Candida. It is easily recognized as a common medical yeast pathogen, existing as part of the normal human flora.-External links:*...

GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis
Kluyveromyces lactis
Kluyveromyces lactis is a Kluyveromyces yeast commonly used for genetic studies and industrial applications. Its name comes from the ability to assimilate lactose and convert it into lactic acid.- Use :...

GGTGTACGGATTTGATTAGGTATGT

Telomeres and cancer



As a cell begins to become cancerous, it divides more often and its telomeres become very short. If its telomeres get too short, the cell may die. It can escape this fate by up-regulating
Downregulation and upregulation
Downregulation is the process by which a cell decreases the quantity of a cellular component, such as RNA or protein, in response to an external variable...

 an enzyme called telomerase
Telomerase
Telomerase is an enzyme that adds DNA sequence repeats to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. This region of repeated nucleotide called telomeres contains non-coding DNA material and prevents constant loss of important DNA from...

, which can prevent telomeres from getting shorter and even elongate them.

Studies have found shortened telomeres in many cancers, including pancreatic, bone, prostate, bladder, lung, kidney, and head and neck. In addition, people with many types of cancer have been found to possess shorter leukocyte telomeres than healthy controls.

Cancer cells require a mechanism to maintain their telomeric DNA in order to continue dividing indefinitely (immortalization). A mechanism for telomere elongation or maintenance is one of the key steps in cellular immortalization and can be used as a diagnostic marker in the clinic. Telomerase, the enzyme complex responsible for elongating telomeres, is activated in approximately 90% of tumors. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids.

Telomerase is the natural enzyme that promotes telomere repair. It is active in stem cell
Stem cell
This article is about the cell type. For the medical therapy, see Stem Cell TreatmentsStem cells are biological cells found in all multicellular organisms, that can divide and differentiate into diverse specialized cell types and can self-renew to produce more stem cells...

s, germ cell
Germ cell
A germ cell is any biological cell that gives rise to the gametes of an organism that reproduces sexually. In many animals, the germ cells originate near the gut of an embryo and migrate to the developing gonads. There, they undergo cell division of two types, mitosis and meiosis, followed by...

s, hair follicles, and 90 percent of cancer cells, but its expression is low or absent in somatic cells. Telomerase functions by adding bases to the ends of the telomeres. Cells with sufficient telomerase activity are considered immortal in the sense that they can divide past the Hayflick limit
Hayflick limit
The Hayflick limit is the number of times a normal cell population will divide before it stops, presumably because the telomeres reach a critical length....

 without entering senescence
Senescence
Senescence or biological aging is the change in the biology of an organism as it ages after its maturity. Such changes range from those affecting its cells and their function to those affecting the whole organism...

 or apoptosis
Apoptosis
Apoptosis is the process of programmed cell death that may occur in multicellular organisms. Biochemical events lead to characteristic cell changes and death. These changes include blebbing, cell shrinkage, nuclear fragmentation, chromatin condensation, and chromosomal DNA fragmentation...

. For this reason, telomerase is viewed as a potential target for anti-cancer drugs (such as telomestatin
Telomestatin
Telomestatin is a macrocyclic chemical compound that acts by inhibiting the telomerase activity of the cancer cells. It was first isolated from the bacteria Streptomyces anulatus. Telomestatin induces the formation of basket-type G-quadruplex structures from hybrid-type G-quadruplexes in the...

).

Studies using knockout mice have demonstrated that the role of telomeres in cancer can both be limiting to tumor growth, as well as promote tumorigenesis, depending on the cell type and genomic context.

Measurement of telomere length in the laboratory


Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot, which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method, termed Q-FISH, involves fluorescent in situ hybridization (FISH). Q-FISH, however, requires significant amounts of genomic DNA (2-20 micrograms) and labor that renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length and Flow-FISH
Flow-FISH
Flow-FISH is a cytogenetic technique to quantify the copy number of specific repetitive elements in genomic DNA of whole cell populations via the combination of flow cytometry with cytogenetic fluorescent in situ hybridization staining protocols...

. RT-PCR assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio, which is demonstrated to be proportional to the average telomere length in a cell.

Another technique, referred to as single telomere elongation length analysis (STELA), was developed in 2003 by Duncan Baird. This technique allows investigations can target specific telomere ends, which is not possible with TRF analysis. However, due to this technique's being PCR-based, telomeres larger than 25Kb cannot be amplified and there is a bias towards shorter telomeres.

Further reading

http://physrev.physiology.org/cgi/reprint/88/2/557
  • Tomaska, L., Nosek, J., Kramara, J., Griffith J.D. (2009). Telomeric circles: universal players in telomere maintenance? Nat. Struct. Mol. Biol. 16: 1010-1015. — A paper detailing the evolutionary origins and medical implications of the vertebrate telomere system, including the pervasive trade-off between cancer prevention and damage repair. Also addresses the probable danger posed by the elongation of telomeres in lab mice.

External links

  • Telomeres and Telomerase: Their Implications in Human Health and Disease online lecture by Elizabeth Blackburn
    Elizabeth Blackburn
    Elizabeth Helen Blackburn, AC, FRS is an Australian-born American biological researcher at the University of California, San Francisco, who studies the telomere, a structure at the end of chromosomes that protects the chromosome. Blackburn co-discovered telomerase, the enzyme that replenishes the...

  • Telomeres and Telomerase: The Means to the End Nobel Lecture by Elizabeth Blackburn
    Elizabeth Blackburn
    Elizabeth Helen Blackburn, AC, FRS is an Australian-born American biological researcher at the University of California, San Francisco, who studies the telomere, a structure at the end of chromosomes that protects the chromosome. Blackburn co-discovered telomerase, the enzyme that replenishes the...

    , which includes a reference to the impact of stress, and pessimism on telomere length
  • Telomerase and the Consequences of Telomere Dysfunction Nobel Lecture by Carol Greider
  • DNA Ends: Just the Beginning Nobel Lecture by Jack Szostak
  • Telome Health, Inc.: telomere science company founded by Elizabeth Blackburn
    Elizabeth Blackburn
    Elizabeth Helen Blackburn, AC, FRS is an Australian-born American biological researcher at the University of California, San Francisco, who studies the telomere, a structure at the end of chromosomes that protects the chromosome. Blackburn co-discovered telomerase, the enzyme that replenishes the...