All Topics  
Telomere

 

   Email Print
   Bookmark   Link






 

Telomere



 
 
A telomere is a region of repetitive DNA
DNA

Deoxyribonucleic acid is a nucleic acid that contains the genetics instructions used in the development and functioning of all known living organisms and some viruses....
 at the end of chromosome
Chromosome

A chromosome is an organized structure of DNA and protein that is found in Cell . A chromosome is a single piece of DNA that contains many genes, regulatory sequence and other genetic sequence....
s, which protects the end of the chromosome from destruction. Its name is derived from the Greek nouns telos (t????) "end" and mer?s (µ????, root: µe?es-) "part".

During cell division
Cell division

Cell division is a process by which a cell , called the parent cell, divides into two or more cells, called daughter cells. Cell division is usually a small segment of a larger cell cycle....
, the enzymes that duplicate the chromosome and its DNA cannot continue their duplication all the way to the end of the chromosome. If cells divided without telomeres, they would lose the end of their chromosomes, and the necessary information it contains.






Discussion
Ask a question about 'Telomere'
Start a new discussion about 'Telomere'
Answer questions from other users
Full Discussion Forum



Encyclopedia


A telomere is a region of repetitive DNA
DNA

Deoxyribonucleic acid is a nucleic acid that contains the genetics instructions used in the development and functioning of all known living organisms and some viruses....
 at the end of chromosome
Chromosome

A chromosome is an organized structure of DNA and protein that is found in Cell . A chromosome is a single piece of DNA that contains many genes, regulatory sequence and other genetic sequence....
s, which protects the end of the chromosome from destruction. Its name is derived from the Greek nouns telos (t????) "end" and mer?s (µ????, root: µe?es-) "part".

During cell division
Cell division

Cell division is a process by which a cell , called the parent cell, divides into two or more cells, called daughter cells. Cell division is usually a small segment of a larger cell cycle....
, the enzymes that duplicate the chromosome and its DNA cannot continue their duplication all the way to the end of the chromosome. If cells divided without telomeres, they would lose the end of their chromosomes, and the necessary information it contains. (In 1972, James Watson
James D. Watson

James Dewey Watson is an American molecular biology, best known as one of the co-discoverers of the structure of DNA. Watson, Francis Crick, and Maurice Wilkins were awarded the 1962 Nobel Prize in Physiology or Medicine "for their discoveries concerning the molecular structure of nucleic acids and its significance for information transfer...
 named this phenomenon the "end replication problem".) The telomeres are disposable buffers blocking the ends of the chromosomes and are consumed during cell division and replenished by an enzyme, the telomerase reverse transcriptase
Telomerase reverse transcriptase

Telomerase reverse transcriptase is a catalytic subunit of the enzyme telomerase. Its absence is associated with the disorder Cri du chat....
.

Elizabeth Blackburn
Elizabeth Blackburn

Elizabeth Helen Blackburn Royal Society is an Australia-born United States biologist at the University of California, San Francisco , who studies the telomere, a structure at the end of chromosomes which protects the chromosome....
 compared telomeres to the tips
Aglet

An aglet or aiglet is a small plastic or metal sheath typically found on the ends of shoelaces, Rope and drawstrings. Aglets keep the fibers from unraveling, and their firmness and narrow profile make them easier to hold and feed through the Grommet, lugs or other lacing guides of the lace or cord....
 on the ends of shoelaces that keep them from unravelling.

In 1975-1977, Blackburn, working as a postdoctoral fellow at Yale University with Joseph Gall
Joseph Gall

Joseph Gall may refer to:* Franz Joseph Gall , neuroanatomist and physiologist* Joseph G. Gall , American cell biologist...
, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Their work was published in 1978.

The telomerase shortening mechanism normally limits cells to a fixed number of divisions, and animal studies suggest that this is responsible for aging on the cellular level and sets a limit on lifespans. Telomeres protect a cell's chromosomes from fusing with each other or rearranging - abnormalities which can lead to cancer
Cancer

Cancer is a class of diseases in which a group of cell display uncontrolled growth , invasion , and sometimes metastasis . These three malignant properties of cancers differentiate them from benign tumors, which are self-limited, do not invade or metastasize....
 - and so cells are normally destroyed when their telomeres are consumed. Biologists speculate that this programmed death of potentially damaged cells reduces the likelihood of cancer but makes aging (and thus death) inevitable. Most cancers are the result of "immortal" cells which have ways of evading this programmed destruction.

Nature and function of telomeres


Telomeres and their function.


Telomeres are repetitive DNA sequences located at the termini of linear chromosomes of most eukaryotic
Eukaryote

Animals, plants, fungus, and protists are eukaryotes , organisms whose Cell are organized into complex structures enclosed within Cell membrane....
 organisms, and a few Prokaryote
Prokaryote

The prokaryotes are a group of organisms that lack a cell nucleus , or any other cell membrane-bound organelles. They differ from the eukaryotes, which have a cell nucleus....
s. Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. The protection against homologous recombination
Homologous recombination

Homologous recombination, also known as general recombination, is a type of genetic recombination that involves a genetic exchange between two similar or identical strands of DNA....
 (HR) and non-homologous end joining
Non-homologous end joining

Non-homologous end joining is a pathway that repairs double-strand breaks in DNA. NHEJ is referred to as "non-homologous" because the break ends are directly ligated without the need for a homologous template, in contrast to homologous recombination, which requires a homologous sequence to guide repair....
 (NHEJ) constitutes the essential “capping” role of telomeres that distinguishes them from DNA double-strand breaks (DSBs) (Lundblad, 2000; Ferreira et al., 2004).

In most Prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication
DNA replication

DNA replication, the basis for heredity, is a fundamental process occurring in all living organisms to copy their DNA. This process is "semiconservative replication" in that each strand of the original double-stranded DNA molecule serves as template for the reproduction of the complementary strand....
 termination. A small fraction of bacteria
Bacteria

The Bacteria are a large group of unicellular microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals....
l chromosomes (such as those in Streptomyces
Streptomyces

Streptomyces is the largest genus of Actinobacteria and the type genus of the family Streptomycetaceae. Over 500 species of Streptomyces bacteria have been described....
 and Borrelia
Borrelia

Borrelia is a genus of bacteria of the spirochete phylum. It causes borreliosis, a zoonotic, vector transmitted primarily by ticks and some by lice, depending on the species....
) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.

In most multicellular eukaryotes, telomerase is only active in germ cell
Germ cell

Germ cells are progenitors of the gametes. These singled-out cells move through the gut to the developing gonads and undergo mitotic Cell proliferation followed by meiosis and Cellular differentiation into either eggs or sperm ....
s. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence
Senescence

Senescence encompasses all of the biological processes of a living organism's approaching an advanced age . The word senescence is derived from the Latin word senex, meaning "old man" or "old age" or "advanced in age"....
 and in the prevention of cancer
Cancer

Cancer is a class of diseases in which a group of cell display uncontrolled growth , invasion , and sometimes metastasis . These three malignant properties of cancers differentiate them from benign tumors, which are self-limited, do not invade or metastasize....
. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

Telomere length varies greatly between species, from ~300-600 bp in yeast (Shampay et al., 1984) to many kilobases in humans, and usually is comprised of arrays of 6-8 bp long G-rich repeats. Eukaryotic telomeres normally terminate with 3' ssDNA overhang which is essential for telomere maintenance and capping. Multiple proteins binding single-and double-stranded telomere DNA have been identified (Blackburn, 2001; Smogorzewska and de Lange, 2004; Cech, 2004; De Lange et al., 2005; Kota and Runge, 1999). These function in both telomere maintenance and capping.

Telomere shortening in humans can induce replicative senescence which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. Malignant cells which bypassed this arrest become immortalized by telomere extension mostly due to the activation of telomerase, the reverse transcriptase enzyme responsible for synthesis of telomeres. However, 5-10% of human cancers activate the Alternative Lengthening of Telomeres (ALT) pathway which relies on recombination mediated elongation.

Human telomeres, cancer, and ALT.

Human somatic cells lacking telomerase gradually lose telomeric sequences as a result of incomplete replication (Counter et al., 1992). As human telomeres grow shorter, eventually cells reach the limit of their replicative capacity and progress into senescence. Senescence involves p53 and pRb pathways and leads to the arrest of cell proliferation
Cell growth

The term cell growth is used in the contexts of Cell development and cell division . When used in the context of cell division, it refers to growth of cell populations, where one cell grows and divides to produce two "daughter cells"....
 (Campisi, 2005). It is thought that senescence plays an important role in suppression of emergence of cancer. However, further cell proliferation can be achieved by inactivation of p53 and pRb pathways. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability, and almost all cells die. Rare cells emerge from crisis immortalized through telomere elongation by either activated telomerase or ALT (Colgina and Reddel, 1999; Reddel and Bryan, 2003). ALT cells exhibit telomeres that are highly heterogeneous in length and often contain multiple telomere binding and recombination, the exact mechanism of this pathway is yet to be determined. ALT cells produce abundant t-circles, possible products of intratelomeric recombination and t-loop resolution (Cesare and Griffith, 2004; Wang et al., 2004).

Telomerase
Telomerase

Telomerase is an enzyme that adds specific DNA sequence repeats to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryote chromosomes....
 is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. The actions of telomerase are necessary because, during replication, DNA polymerase
DNA polymerase

A DNA polymerase is an enzyme that catalyze the polymerization of deoxyribonucleotides into a DNA strand. DNA polymerases are best-known for their role in DNA replication, in which the polymerase "reads" an intact DNA strand as a template and uses it to synthesize the new strand....
 can only synthesize DNA in a 5' to 3' direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. This replacement of the RNA primers is not a problem at origins of replication within the chromosome because DNA polymerase can use a previous stretch of DNA 5' to the RNA template as a template to backfill the sequence where the RNA primer was; at the terminal end of the chromosome, however, DNA polymerase cannot replace the RNA primer because there is no position 5' of the RNA primer where another primer can be placed nor is there DNA upstream that can be used as a primer so that DNA polymerase can replace the RNA primer. Without telomeres at the end of DNA, this genetic sequence at the end of the chromosome would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerase
Telomerase

Telomerase is an enzyme that adds specific DNA sequence repeats to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryote chromosomes....
s, part of a protein subgroup of specialized reverse transcriptase
Reverse transcriptase

In biochemistry, a reverse transcriptase, also known as RNA-dependent DNA polymerase, is a DNA polymerase enzyme that transcription single-stranded RNA into double-stranded DNA....
 enzymes known as TERT
Telomerase reverse transcriptase

Telomerase reverse transcriptase is a catalytic subunit of the enzyme telomerase. Its absence is associated with the disorder Cri du chat....
 (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms, oxidative stress, and because TERT expression is very low in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cell
Stem cell

Stem cells are Cell found in most, if not all, multi-cellular organisms. They are characterized by the ability to renew themselves through Mitosis cell division and Cellular differentiation into a diverse range of specialized cell types....
s and certain white blood cell
White blood cell

White blood cells , or leukocytes , are cell of the immune system defending the body against both infectious disease and foreign materials....
s, TERT is expressed at higher levels and telomere shortening is partially or fully prevented.

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In human
Human

A human being, also human or man, is a member of a species of bipedalism primates in the family Hominidae . Mitochondrial DNA evidence indicates that modern humans originated in east Africa about 200,000 years ago....
s, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but generally one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures (G-quadruplex
G-quadruplex

Nucleic acid sequences which are rich in guanine are capable of forming four-stranded structures called G-quadruplexes . These consist of a square arrangement of guanines , stabilized by Hoogsteen base pair hydrogen bonding....
es), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes.

If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence
Senescence

Senescence encompasses all of the biological processes of a living organism's approaching an advanced age . The word senescence is derived from the Latin word senex, meaning "old man" or "old age" or "advanced in age"....
, growth arrest or apoptosis
Apoptosis

Apoptosis is the process of programmed cell death that may occur in multicellular organisms. Programmed Cell death involves a series of biochemical events leading to a characteristic cell Morphology and death, in more specific terms, a series of biochemical events that lead to a variety of morphological changes, including Bleb , changes...
 depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex.

A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

Telomere shortening

Dnareplication
"Telomeres" shorten partly (see below) because of the end replication problem that is exhibited during DNA replication in eukaryote
Eukaryote

Animals, plants, fungus, and protists are eukaryotes , organisms whose Cell are organized into complex structures enclosed within Cell membrane....
s only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerase
DNA polymerase

A DNA polymerase is an enzyme that catalyze the polymerization of deoxyribonucleotides into a DNA strand. DNA polymerases are best-known for their role in DNA replication, in which the polymerase "reads" an intact DNA strand as a template and uses it to synthesize the new strand....
s that have been discovered move in the 5' to 3' direction
Directionality (molecular biology)

Directionality, in molecular biology, refers to the end-to-end chemical orientation of a single strand of nucleic acid. The chemical convention of naming carbon atoms in the nucleotide Furanose numerically gives rise to a 5' end and a 3' end ....
, one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA
RNA

Ribonucleic acid is a type of molecule that consists of a long chain of nucleotide units. Each nucleotide consists of a nucleobase, a ribose sugar, and a phosphate....
 acting as primer
Primer (molecular biology)

A primer is a strand of nucleic acid that serves as a starting point for DNA replication. They are required because the enzymes that catalyze replication, DNA polymerases, can only add new nucleotides to an existing strand of DNA....
s attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragment
Okazaki fragment

An Okazaki fragment is a relatively short fragment of DNA created on the lagging strand during DNA replication. The lengths of Okazaki fragments are between 1,000 to 2,000 nucleotides long in E....
s. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease and DNA ligase
DNA ligase

In molecular biology, DNA ligase is a special type of ligase that can link together two DNA strands that have double-strand break . The alternative, a single-strand break, is fixed by a different type of DNA ligase using the Complementary DNA as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair...
 come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of lagging strand.

However, in vitro studies (von Zglinicki et al. 1995, 2000) have shown that telomeres are highly susceptible to oxidative stress. Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem (ca. 20 bp) and actual telomere shortening rates (50-100 bp), and has a greater absolute impact on telomere length than shortening caused by the end-replication problem.

Lengthening telomeres

The phenomenon of limited cellular division was first observed by Leonard Hayflick
Leonard Hayflick

Leonard Hayflick , Doctor of Philosophy, is Professor of Anatomy at the University of California, San Francisco, School of Medicine, and was Professor of Medical Microbiology at Stanford University School of Medicine....
, and is now referred to as the Hayflick limit
Hayflick limit

The Hayflick limit is the number of times a cell will divide before it stops due to the telomere reaching a critical length....
. Significant discoveries were made by the team led by Professor Elizabeth Blackburn
Elizabeth Blackburn

Elizabeth Helen Blackburn Royal Society is an Australia-born United States biologist at the University of California, San Francisco , who studies the telomere, a structure at the end of chromosomes which protects the chromosome....
 at the University of California, San Francisco
University of California, San Francisco

The University of California, San Francisco is one of the world's leading centers of health sciences research, patient care, and education. UCSF's medical, pharmacy, dentistry, nursing, and graduate schools are among the top health science professional schools in the world....
 (UCSF).

Advocates of human life extension
Life extension

Life extension refers to an increase in maximum lifespan or Life expectancy, especially in humans, by slowing down or reversing the senescence. Average lifespan is heavily influenced by infant mortality and child mortality, which are frequently linked to infectious diseases or nutrition problems....
 promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy
Gene therapy

Gene therapy is the insertion of genes into an individual's cell and Biological tissues to treat a disease, such as a hereditary disease in which a deleterious mutant allele is replaced with a functional one....
. They reason that this would extend human life. So far these ideas have not been proven in humans.

However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, in that lengthening telomeres might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).

A study done with the nematode
Nematode

The "roundworms" or "nematodes" are the most diverse phylum of body cavity, and one of the most diverse of all animals. Nematode species are very difficult to distinguish; over 80,000 have been described, of which over 15,000 are parasite....
 worm species Caenorhabditis elegans
Caenorhabditis elegans

'Caenorhabditis elegans' is a free-living, transparent nematode , about 1 mm in length, which lives in temperate soil environments. Research into the molecular biology and developmental biology of C....
 indicates that there is a correlation
Correlation

In probability theory and statistics, correlation indicates the strength and direction of a linear relationship between two random variables....
 between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein
Protein

Proteins are organic compounds made of amino acids arranged in a linear chain and joined together by peptide bonds between the carboxyl and amino groups of adjacent amino acid Residue ....
 HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms.

Techniques to extend telomeres could be useful for tissue engineering
Tissue engineering

Tissue engineering is the use of a combination of Cell s, engineering and Materials science methods, and suitable biochemistry and physio-chemical factors to improve or replace biology functions....
, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Changing telomere lengths are usually associated with changing speed of senescence, however this telomere shortening might be a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabird
Seabird

Seabirds are birds that have adaptation to life within the marine environment. While seabirds vary greatly in lifestyle, behavior and physiology, they often exhibit striking convergent evolution, as the same environmental problems and feeding ecological niche have resulted in similar adaptations....
s:

In 2003, scientists observed that the telomeres of Leach's Storm-petrel
Leach's Storm-petrel

The Leach's Storm-petrel or Leach's Petrel is a small seabird of the tubenose family. It is named after the British zoologist William Elford Leach....
 (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. In 2006, Juola et al. reported that in another, unrelated long-lived seabird species, the Great Frigatebird
Great Frigatebird

The Great Frigatebird is a large bird migration#Irruptions and dispersal seabird in the frigatebird family . Major nesting populations are found in the Pacific and Indian Oceans, as well as a population in the South Atlantic....
 (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebird
Frigatebird

The frigatebirds are a family, Fregatidae, of seabirds. There are five species in the single genus Fregata. They are also sometimes called Man of War birds or Pirate birds....
s and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

The telomere length varies in cloned animals. Sometimes the clones end up with shorter telomeres since the DNA has already divided countless times. Occasionally, the telomeres in a clone's DNA are longer because they get "reprogrammed". The clone's new telomeres combine with the old ones, giving it abnormally long telomeres.

Sierra Sciences
Sierra Sciences

Sierra Sciences, LLC is a biotechnology company founded by William H. Andrews, former director of molecular biology at Geron Corporation. Andrews founded Sierra Sciences in 1999 in Reno, Nevada with the goal of preventing and/or reversing senescence, and ultimately curing diseases associated with human aging, including the aging process itse...
, a biotechnology company in Reno, NV, has discovered a small-molecule, drug-like compound that turns on the expression of telomerase in human cells. Their scientists are presently characterizing its mechanism of action.

Telomere Length Assay


Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method, termed Q-FISH, involves fluorescent in situ hybridization (FISH). Q-FISH, however, requires significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length and Flow-FISH
Flow-FISH

Flow-FISH is a cytogenetic technique to quantify the copy number of specific repetitive elements in genomic DNA of whole cell populations via the combination of flow cytometry with cytogenetic fluorescent in situ hybridization staining protocols....
. RT-PCR assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demonstrated to be proportional to the average telomere length in a cell. The Real-Time PCR assay has been since scaled up to high-throughput 384-well format use; making the assay feasible for use in large cohort studies. Flow-FISH is an adaptation of the Q-FISH telomere quantitation technique that uses a flow cytometer to measure median fluorescence of a population of cells, thus reducing labor requirements and increasing reproducibility. Flow-FISH has been scaled up to the 96-well format.

Another technique referred to as single telomere elongation length analysis (STELA) was developed in 2003 by Duncan Baird. This technique is a PCR based technique. As a result it is has a much higher resolution than previous telomere length analysis techniques. Also due to the fact that chromosome specific primers can be used, investigations can target specific telomere ends. This is something that is not possible with TRF analysis. However due to this technique being PCR based, telomeres larger than 25Kb cannot be amplified, and there is a bias towards shorter telomeres. This can be problematic when analysing ALT positive cell lines as these have very heterogeneous telomere lengths, and can exhibit telomeres as large as 50Kb.

Telomere sequences

Some known telomere sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrate
Vertebrate

Vertebrates are members of the subphylum Vertebrata, chordates with Vertebras or Vertebral columns. The grouping sometimes includes the hagfish, which have no vertebrae, but are genetically quite closely related to lampreys, which do have vertebrae....
s
Human
Human

A human being, also human or man, is a member of a species of bipedalism primates in the family Hominidae . Mitochondrial DNA evidence indicates that modern humans originated in east Africa about 200,000 years ago....
, mouse, Xenopus
TTAGGG
Filamentous fungi
Fungus

A fungus is a Eukaryote organism that is a member of the Kingdom Fungi . The fungi are a monophyletic group, also called the Eumycota , that is phylogeny distinct from the morphologically similar slime molds and water molds ....
Neurospora crassa
Neurospora crassa

Neurospora crassa is a type of red bread mold of the phylum Ascomycota. The genus name, meaning "nerve spore" refers to the characteristic striations on the spores....
TTAGGG
Slime mould
Slime mould

Slime mold is a broad term describing fungi amoeboid organisms. Their common name refers to part of some of these organism's life cycles where they can appear gelatinous ....
s
Physarum, Didymium TTAGGG
Dictyostelium
Dictyostelid

The dictyostelids are a group of cellular slime molds, or social amoebae. When food, normally bacteria, is readily available they are individual amoebae, which feed and divide normally....
AG(1-8)
Kinetoplastid
Kinetoplastid

The kinetoplastids are a group of flagellate protozoa, including a number of parasites responsible for serious diseases in humans and other animals, as well as various forms found in soil and aquatic environments....
 protozoa
Trypanosoma
Trypanosoma

Trypanosoma are of the class kinetoplastida, a monophyletic group of unicellular parasite protozoa. The name is derived from the Greek language trypano and soma because of their corkscrew-like motion....
, Crithidia
Crithidia

Crithidia are members of the trypanosome protozoa. They are parasites that exclusively parasitise arthropods, mainly insects. They pass from host to host as cysts in infective faeces and typically, the parasites develop in the digestive tracts of insects and interact with the intestinal epithelium using their flagellum....
TTAGGG
Ciliate
Ciliate

The ciliates are a group of protists characterized by the presence of hair-like organelles called cilium, which are identical in structure to flagellum but typically shorter and present in much larger numbers with a different undulating pattern than flagella....
 protozoa
Tetrahymena
Tetrahymena

Tetrahymena are free-living ciliate protozoa that can also switch from commensalism to pathogenic modes of survival. They are common in fresh-water....
, Glaucoma
TTGGGG
Paramecium
Paramecium

Paramecia, also known as Lady Slippers, due to their appearance, are a group of unicellular ciliate protozoa, which are commonly studied as a representative of the ciliate group, and range from about 50 to 350 micrometre in length, Simple cilia cover the body, which allow the cell to move with a synchronous motion ....
TTGGG(T/G)
Oxytricha, Stylonychia
Stylonychia

Stylonychia is a genus of ciliate, included among the stichotrichs. It is very common in fresh water and soil, found on filamentous algae, surface films, and among particles of sediment....
, Euplotes
TTTTGGGG
Apicomplexa
Apicomplexa

The Apicomplexa are a large group of protists, characterized by the presence of a unique organelle called an apical complex . They are unicellular, spore-forming, and exclusively parasites of animals....
n protozoa
Plasmodium
Plasmodium

Plasmodium is a genus of parasitic protozoa. Infection with these parasites is known as malaria. The genus Plasmodium was created in 1885 by Ettore Marchiafava and Angelo Celli....
TTAGGG(T/C)
Higher plant
Plant

Plants are Life organisms belonging to the Kingdom Plantae. They include familiar organisms such as trees, herbs, bushes, grasses, vines, ferns, mosses, and green algae....
s
Arabidopsis thaliana
Arabidopsis thaliana

Arabidopsis thaliana , is a small flowering plant native to Europe, Asia, and northwestern Africa. A spring annual with a relatively short life cycle, Arabidopsis is popular as a model organism in plant biology and genetics....
TTTAGGG
Green algae Chlamydomonas
Chlamydomonas

Chlamydomonas is a genus of green alga. They are unicellular flagellates. Chlamydomonas is used as a model organism for molecular biology, especially studies of flagellum motility and chloroplast dynamics, biogenesis, and genetics....
TTTTAGGG
Insect
Insect

Insects are the biggest class of arthropods and the only ones with wings. They are the most diverse group of animals on the planet. They are most diverse at the equator and their diversity declines toward the poles....
s
Bombyx mori
Bombyx mori

The silkworm is the larva or caterpillar of Bombyx mori , the domesticated silkmoth. A moth in the family Bombycidae, it is very important economically as the producer of silk....
TTAGG
Roundworms Ascaris lumbricoides
Ascaris lumbricoides

Ascaris lumbricoides is the member of the Ascaris family responsible for the disease Ascariasis.It can reach a length of up to 35 cm....
TTAGGC
Fission yeast
Yeast

Yeasts are eukaryote microorganisms classified in the Kingdom fungus, with about 1,500 species currently described; they dominate fungal diversity in the oceans....
s
Schizosaccharomyces pombe
Schizosaccharomyces pombe

Schizosaccharomyces pombe, also called "fission yeast", is a species of yeast. It is used as a model organism in molecular biology and cell biology....
TTAC(A)(C)G(1-8)
Budding yeast
Yeast

Yeasts are eukaryote microorganisms classified in the Kingdom fungus, with about 1,500 species currently described; they dominate fungal diversity in the oceans....
s
Saccharomyces cerevisiae
Saccharomyces cerevisiae

Saccharomyces cerevisiae is a species of budding yeast. It is perhaps the most useful yeast owing to its use since ancient times in baking and brewing....
TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Candida glabrata
Candida glabrata

Candida glabrata is a haploid yeast of the genus Candida , previously known as Torulopsis glabrata. This species of yeast is non-Phenotypic switching and no mating activity has been observed....
GGGGTCTGGGTGCTG
Candida albicans
Candida albicans

Candida albicans is a diploid fungus , which is capable of sexual reproduction but not of meiosis, and a causal agent of Opportunistic infection Wiktionary:oral and genital infections in humans....
GGTGTACGGATGTCTAACTTCTT
Candida tropicalis
Candida tropicalis

Candida tropicalis is a species of yeast in the genus Candida. It is easily recognized as a common medical yeast pathogen, existing as part of the normal human flora....
GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis
Kluyveromyces lactis

Kluyveromyces lactis is a Kluyveromyces yeast commonly used for Genetics studies and industrial applications. Its name comes from the ability to assimilate lactose and convert it into lactic acid....
GGTGTACGGATTTGATTAGGTATGT


Systemic telomere length and aging

As a measure of systemic telomere length, generally, peripheral blood leukocyte telomere length is preferred. Systemic telomere length has been proposed as a marker of biological aging. A subject's systemic telomere length is predominantly genetically determined, but has several other known determinants: age (shorter telomeres in older people), paternal age at birth (longer telomeres in subjects with older fathers at their birth) and sex (shorter telomeres in men, probably due to a faster telomere attrition). Evidence suggests that elevated levels of oxidative stress and inflammation further increase the telomere attrition rate.

Vitamin D may have an effect on peripheral blood leukocyte telomere length. Richards and coworkers examined whether vitamin D
Vitamin D

Vitamin D is a group of fat-soluble prohormones, the two major forms of which are vitamin D2 and vitamin D3 . The term vitamin D also refers to metabolites and other analogues of these substances....
 concentrations would slow the rate of shortening of leukocyte telomeres. The authors stated that vitamin D is a potent inhibitor
Inhibitor

Inhibitor or inhibition may refer to:* Corrosion inhibitor, a substance that decreases the rate of metal oxidation* Enzyme inhibitor, a substance that binds to an enzyme and decreases the enzyme's activity...
 of the proinflammatory response and slows the turnover of leukocytes. Leukocyte telomere length (LTL) predicts the development of aging-related disease, and length of these telomeres decreases with each cell division and with increased inflammation. Researchers measured serum vitamin D concentrations in 2160 women aged 18-79 years (mean age: 49.4) from a large population-based cohort of twins. This study divided the group into thirds [tertiles http://en.wiktionary.org/wiki/tertile] based on vitamin D levels, and found that increased age was significantly associated with shorter LTL (r = -0.40, P < 0.0001). Higher serum vitamin D concentrations were significantly associated with longer LTL (r = 0.07, P = 0.0010), and this finding persisted even after adjustment for age (r = 0.09, P < 0.0001) and other variables that independently could affect LTL (age, season of vitamin D measurement, menopausal status, use of hormone replacement therapy
Hormone replacement therapy

Hormone replacement therapy may refer to:*Hormone replacement therapy *Hormone replacement therapy *Hormone replacement therapy *Androgen replacement therapy ...
, and physical activity). The difference in LTL between the highest and lowest tertiles of vitamin D was highly significant (P = 0.0009), and the authors stated that this was equivalent to 5.0 years of aging. The authors concluded that higher vitamin D levels, (easily modifiable through nutritional supplementation), were associated with longer LTL, which underscores the potentially beneficial effects of vitamin D on aging and age-related diseases.

Telomeres and cancer

Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase
Telomerase

Telomerase is an enzyme that adds specific DNA sequence repeats to the 3' end of DNA strands in the telomere regions, which are found at the ends of eukaryote chromosomes....
. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.

Telomerase is the natural enzyme which promotes telomere repair. It is however not active in most cells. It certainly is active though in stem cells, germ cells, hair follicles and in 90 percent of cancer cells. Telomerase functions by adding bases to the ends of the telomeres. As a result of this telomerase activity, these cells seem to possess a kind of immortality.

Studies using knockout mice have demonstrated that the role of telomeres in cancer can both be limiting to tumor growth, as well as promote tumorigenesis, depending on the cell type and genomic context

Telomeres and cardiovascular aging

Shorter (systemic) telomere length has been suggested as an independent risk factor for cardiovascular disease. The origin of this association is unclear and several models have been proposed, particularly attributing the biomarker value to a genetic prediposition in subjects with shorter telomeres, to an effect of inflammation and oxidative stress or to a combination of both.

Telomeres in forensic science

A 2002 Japanese study found that an individual's age can be roughly estimated from the length of their telomeres, making it possible to determine the age of any forensic sample that contains well-preserved DNA. Formerly, forensic scientists were forced to rely on morphological characteristics (such as the growth and decay of bones
Bone

Bones are rigid organ that form part of the endoskeleton of vertebrates. They function to move, support, and protect the various organs of the body, produce red blood cell and white blood cells and store minerals....
) to determine an individual's age.

Telomeres in Pop Culture

Telomeres, and their function in the chromosome reproduction, are referred to as an integral part of the plot of the The Kindred (part 2) episode of the science fiction television series Stargate Atlantis
Stargate Atlantis

Stargate Atlantis is an United States-Canada science fiction television program, part of the Stargate owned by Metro-Goldwyn-Mayer. Developed by producers Brad Wright and Robert C....
, which first aired in the United States on February 29, 2008, on the Sci-Fi Channel
Sci Fi Channel (United States)

Sci Fi Channel, often stylized SCI FI Channel, is an American cable television channel, launched on September 24, 1992, that specializes in science fiction, fantasy, horror film, and paranormal programming....
.

In the anime series Gundam SEED (as well as its sequel, Mobile Suit Gundam SEED Destiny
Mobile Suit Gundam SEED Destiny

is the second anime television series set in the Cosmic Era universe of Gundam by Sunrise . Set two years after the original Mobile Suit Gundam SEED, Gundam SEED Destiny features many new characters and some returning ones....
), shorter telomeres are the reason why clones such as Rey Za Burrel
Rey Za Burrel

is a fictional character and antagonist from the anime series, Mobile Suit Gundam SEED Destiny. Rey is a quiet,calm,and polite soldier who keeps himself out of other people's way, he gladly follows his orders no matter what they might be....
 age and die faster than people who were born naturally, whose telomeres are therefore longer.

The novel Rollback by Robert J. Sawyer
Robert J. Sawyer

Robert James Sawyer is a Canada science fiction writer, born in Ottawa in 1960 and now resident in Mississauga. He has published 18 novels, and his short fiction has appeared in Analog Science Fiction and Fact, Amazing Stories, On Spec, Nature, and numerous anthologies....
 is centered around the lengthening of telomeres as a means of increasing one's lifespan.

In the novel Turnabout by Margaret Peterson Haddix, injections stop the telomeres from shortening and cause the main characters to 'unage'.

In the PlayStation 3
PlayStation 3

The PlayStation 3 is the third home video game console produced by Sony Computer Entertainment, and the successor to the PlayStation 2 as part of the PlayStation ....
 game Metal Gear Solid 4, Solid Snake was cloned with shortened telomeres, which is the explanation for his rapid aging.

In the TV Series Eleventh Hour one of the main antagonists, a geneticist with the alias Geppetto, has found a way to lengthen telomeres thereby reducing the effects of aging on the quality of the host's DNA.

Additional reading

  • — A paper detailing the evolutionary origins and medical implications of the vertebrate telomere system, including the pervasive trade-off between cancer prevention and damage repair. Also addresses the probable danger posed by the elongation of telomeres in lab mice.


External links

  • on-line lecture by Elizabeth Blackburn
    Elizabeth Blackburn

    Elizabeth Helen Blackburn Royal Society is an Australia-born United States biologist at the University of California, San Francisco , who studies the telomere, a structure at the end of chromosomes which protects the chromosome....