Listeria monocytogenes non-coding RNA

Listeria monocytogenes is a gram positive bacterium and causes many food-borne infections such as Listeriosis. This bacteria is ubiquitous in the environment where it can act as either a saprophyte when free living within the environment or as a pathogen

Pathogen

A pathogen gignomai "I give birth to") or infectious agent — colloquially, a germ — is a microbe or microorganism such as a virus, bacterium, prion, or fungus that causes disease in its animal or plant host...

when entering a host organism. Many non-coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non-coding RNAs and may contribute to pathogenesis

Pathogenesis

The pathogenesis of a disease is the mechanism by which the disease is caused. The term can also be used to describe the origin and development of the disease and whether it is acute, chronic or recurrent...

.

Tiling arrays

Tiling array

Tiling Arrays are a subtype of microarray chips. Like traditional microarrays, they function by hybridizing labeled DNA or RNA target molecules to probes fixed onto a solid surface. Tiling arrays differ from traditional microarrays in the nature of the probes...

and mutagenesis

Mutagenesis

Mutagenesis is a process by which the genetic information of an organism is changed in a stable manner, resulting in a mutation. It may occur spontaneously in nature, or as a result of exposure to mutagens. It can also be achieved experimentally using laboratory procedures...

identified many non-coding RNAs within the L. monocytogenes genome

Genome

In modern molecular biology and genetics, the genome is the entirety of an organism's hereditary information. It is encoded either in DNA or, for many types of virus, in RNA. The genome includes both the genes and the non-coding sequences of the DNA/RNA....

and the location of these non-coding RNAs within the bacterial genome was confirmed by RACE (rapid amplification of cDNA ends) analysis. These studies showed that the expression of many non-coding RNAs was dependent on the environment and that several of these non-coding RNAs act as as cis-regulatory elements

Cis-regulatory element

A cis-regulatory element or cis-element is a region of DNA or RNA that regulates the expression of genes located on that same molecule of DNA . This term is constructed from the Latin word cis, which means "on the same side as". These cis-regulatory elements are often binding sites for one or...

. Comparisons between previously characterized non-coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non-coding RNAs in L. monocyotogenes. An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non-coding RNAs that are only present within L. monocytogenes which suggests that these ncRNAs may have a role in pathogenesis

Pathogenesis

. The tables below summarizes the location, flanking gene

Gene

A gene is a molecular unit of heredity of a living organism. It is a name given to some stretches of DNA and RNA that code for a type of protein or for an RNA chain that has a function in the organism. Living beings depend on genes, as they specify all proteins and functional RNA chains...

s and also the characteristics of the novel small non-coding RNAs identified and the previously characterized non-coding RNAs present in L. monocytogenes

Novel Non-coding RNAs

ID	Start	Stop	Size	5' flanking gene	sense of the gene on the genome	^a		3' flanking gene	Characteristic
rli22	31997	32107	110	lmo0028	->	->	->	lmo0029	sRNA
rli23	172171	172268	97	lmo0172	<-	->			sRNA Antisense to lmo0172 transposase Homolog of rli25 and rli35.
rli24	271029	271186	157	lmo0256	->	->	->	lmo0257	sRNA
rli25	357618	357516	102	lmo0330	->	<-			sRNA Antisense to lmo0330: transposase. Homolog of rli23 and rli35
rli26	388707	388520	187	lmo0360	->	<-	<-	lmo0361	sRNA
rli27	434831	434929	98	lmo0411	<-	->	<-	lmo0412	sRNA
rli28	507394	507206	188	lmo0470	->	<-	->	lmo0471	sRNA Homolog of rli50
rli29	507643	507450	193	lmo0470	->	<-	->	lmo0471	sRNA Antisense to the 5'UTR of lmo0471
rli30	540785	540670	115	lmo0506	->	<-			sRNA Antisense to lmo0506
rli31	597812	597926	114	lmo0558	<-	->	->	lmo0559	sRNA
rli32	600750	600604	147	lmo0560	<-	<-	<-	lmo0561	sRNA
rli33	708326	708860	534	lmo0671	->	->	->	lmo0672	sRNA
rli34	803031	802948	83	lmo0777	->	<-	->	lmo0778	sRNA
rli35	855495	855393	102	lmo0828	->	<-			sRNA Antisense to lmo0828: transposase. Homolog of rli23 and rli25
rli36	859527	859444	83	nifJ	->	<-	<-	fbp	sRNA
rli37	907576	907832	256	lmo0866	->	->	->	lmo0867	ORF ORF of 58aa. RBS region: TGATACGGGAGTGTGGTGCTAGTTATG
rli38	1152549	1152917	369	lmo1115	<-	->	->	lmo1116	sRNA role in virulence
rli39	1179807	1179993	187	lmo1149	->	->	<-	lmo1150	sRNA Annotated as a cobalamin riboswitch in Rfam
rli40	1275810	1275547	264	lmo1251	->	<-	<-	lmo1252	ORF ORF of 64 aa. RBS region: AGTGAGGCGTCCTTATG
rli41	1277207	1276713	495	lmo1252	<-	<-	->	lmo1253	Two ORFs ORF of 45 aa. RBS region: AGAGGAGGTATTTTCTATG ORF of 35 aa. RBS region:AAGGAGGAAAACAAATTG
rli42	1399617	1399447	171	lmo1374	->	<-	->	lmo1375	sRNA
rli43	1861630	1861377	253	inlC	<-	<-	<-	rplS	ORF ORF of 35aa. RBS region: AGAGTGAGGTGTAATATG
rli44	2039087	2039375	289	lmo1964	<-	->	<-	lmo1965	ORF ORF of 28aa. RBS region: GGAAAGGATAACCCATG
rli45	2154775	2154852	77	lmo2074	->	->	<-	lmo2075	sRNA Antisense to rli46
rli46	2155058	2154765	294	lmo2074	->	<-	<-	lmo2075	sRNA Antisense to rli45
rli47	2226024	2226532	508	lmo2141	->	->	<-	lmo2142	sRNA
rli48	2361423	2361274	149	lmo2271	<-	<-	->	lmo2272	sRNA
rli49	2660179	2660364	185	lmo2579	->	->	<-	lmo2580	sRNA
rli50	2783274	2783098	176	lmo2709	->	<-	<-	lmo2710	sRNA Homolog of rli28
rli51	207589	207709	120	hly	->	->	->	mpl	5'-UTR-derived Increased in intestinal lumen
rli52	552421	552327	94	lmo0517	<-	<-	<-	lmo0518	5'-UTR-derived Putative riboswitch.
rli53	955829	956001	172	lmo0918	->	->	->	lmo0919	5'-UTR-derived Putative riboswitch.
rli54	1078584	1079111	527	lmo1051	<-	->	->	pdhA	5'-UTR-derived Putative riboswitch.
rli55	1198107	1198389	282	lmo1170	->	->	->	pduQ	5'-UTR-derived Putative riboswitch.
rli56	1199859	1199958	99	pduQ	->	->	->	lmo1172	5'-UTR-derived Putative riboswitch.
rli57	?	1216658	?	lmo1190	->	->	->	cbiA	3'-UTR-derived Annotated as a cobalamin riboswitch in Rfam lmo1190-rli57 transcript levelncreasedinintestinal lumen
rli58	?	1639974	?	rpsD	->	<-	<-	lmo1597
rli59	1702553	1702373	180	lmo1652	<-	<-	<-	lmo1653	5'-UTR-derived
rli60	2054124	2054308	184	lmo1982	<-	->	->	ilvD	5'-UTR-derived Putative riboswitch.
rli61	2275363	2275258	106	lmo2187	<-	<-	<-	lmo2188	5'-UTR-derived Putative riboswitch
rli62	2364508	2364337	172	lmo2277	<-	<-	<-	lmo2278	5'-UTR-derived Putative riboswitch.
rli63	2613301	?	?	atpI	<-	<-	<-	lmo2537	5'-UTR-derived Putative riboswitch
rliA	513584	513807	224	lmo0476	<-	>-	>-	lmo0477	snRNA
rliB	544357	544716	360	lmo0509	->	->	->	lmo0510	sRNA
rliC	1154309	1154671	363	lmo1117	->	->	<-	lmo1118	sRNA
rliD	1359529	1359202	328	rpsO	->	<-	->	pnpA	sRNA antisense
rliE	1584586	1584808	223	comC	<-	->	<-	folC	sRNA antisense to comC mRNA
rliF	2106292	2106073	220	nadA	->	<-	<-	lmo2026	snRNA
rliG	2386992	2386715	278	lmo2302	<-	<-	<-	lmo2303	sRNA
rliH	1180826	1181254	429	lmo1150	<-	->	->	lmo1151	sRNA antisense
rliI	2842200	2841962	239	lmo2760	<-	<-	->	lmo2761	sRNA
sbrA	1399363	1399433	70	lmo1374	->	->	->	lmo1375	sRNA

^aArrows indicate the sense of the gene on the genome. Bold arrows indicate gene absent from L. innocua.

Listeria monocytogenes EGD-e strain was used in these studies EMBL accession AL591824.1

Characterised non-coding RNAs

ID	Rfam	ID	Rfam
SAM SAM riboswitch (S box leader) The SAM riboswitch is found upstream of a number of genes which code for proteins involved in methionine or cysteine biosynthesis in Gram-positive bacteria. Two SAM riboswitches in Bacillus subtilis that were experimentally studied act at the level of transcription termination control...	RF00162	PrfA PrfA thermoregulator UTR The PrfA thermoregulator UTR is an RNA thermometer found in the 5' UTR of the prfA gene. In Listeria monocytogenes, virulence genes are maximally expressed at 37°C but are almost silent at 30°C. The genes are controlled by PrfA, a transcriptional activator whose expression is thermoregulated...	RF00038
LhrC	RF00616	L10 leader Ribosomal protein L10 leader This family is a putative ribosomal protein leader autoregulatory structure found in B. subtilis and other low-GC Gram-positive bacteria. It is located in the 5' untranslated regions of mRNAs encoding ribosomal proteins L10 and L12...	RF00557
TPP TPP riboswitch (THI element) The TPP riboswitch, also known as the THI element and Thi-box riboswitch, is a highly conserved RNA secondary structure. It serves as a riboswitchthat binds directly to thiamine pyrophosphate to regulate gene expression through a variety of mechanisms in archaea, bacteria and eukaryotes...	RF00059	Purine Purine riboswitch Purine riboswitches are RNA structures that regulate protein biosynthesis in response to purines. In general, riboswitches are metabolite-binding domains within certain messenger RNAs that act as precision sensors for their corresponding targets...	RF00167
glmS GlmS glucosamine-6-phosphate activated ribozyme The Glucosamine-6-phosphate activated ribozyme is an RNA structure that is both a ribozyme, since it catalyzes a chemical reaction, and a riboswitch, since it regulates genes in response to concentrations of a metabolite....	RF00234	lysine Lysine riboswitch The Lysine riboswitch is a metabolite binding RNA element found within certain messenger RNAs that serve as a precision sensor for the amino acid lysine. Allosteric rearrangement of mRNA structure is mediated by ligand binding, and this results in modulation of gene expression. This riboswitch is...	RF00168
PreQ1	RF00522	yybP-ykoY YybP-ykoY leader The yybP-ykoY leader RNA element was originally discovered in E. coli during a large scale screen and was named SraF. This family was later found to exist upstream of related families of protein genes in many bacteria, including the yybP and ykoY genes in B. subtilis...	RF00080
T-box T-box leader The T-box leader element is involved in the regulation of translation associated genes, usually in gram-positive bacteria. Typically T-box leaders are found upstream of aminoacyl-tRNA synthetase genes and some amino acid biosynthetic genes. Uncharged tRNA acts as the effector for transcription...	RF00230	glycine Glycine riboswitch The bacterial glycine riboswitch is an RNA element that can bind the amino acid glycine. Glycine riboswitches usually consist of two metabolite-binding aptamers domains with similar structures in tandem. The aptamers cooperatively bind glycine to regulate the expression of downstream genes...	RF00504
SsrS 6S / SsrS RNA 6S RNA was the first noncoding RNA to be sequenced, but its function was unknown until recently. It consists of 184 nucleotides that fold into an extended hairpin structure with a large single-stranded internal bulge....	RF00013	L21 Ribosomal protein L21 leader This family is a putative ribosomal protein leader autoregulatory structure found in B. subtilis and other low-GC Gram-positive bacteria. It is located in the 5' untranslated regions of mRNAs encoding ribosomal protein L21, a protein of unknown function, and ribosomal protein L27 .Other ribosomal...	RF00559
LhrB Ribosomal protein L20 leader This family is a putative ribosomal protein leader autoregulatory structure found in B. subtilis and other low-GC Gram-positive bacteria. It is located in the 5' untranslated regions of mRNAs encoding initiation factor 3 followed by ribosomal proteins L35 and L20...	RF00558	RyrR PyrR binding site The PyrR binding site is an RNA element that is found upstream of a variety of genes involved in pyrimidine biosynthesis and transport.The RNA structure permits binding of PyrR protein which regulates pyrimidine biosynthesis in Bacillus subtilis. When the protein binds, a downstream terminator...	RF00515
FMN	RF00050	LhrA	RF00615
ssrA TmRNA Transfer-messenger RNA is a bacterial RNA molecule with dual tRNA-like and messenger RNA-like properties. The tmRNA forms a ribonucleoprotein complex together with Small Protein B , Elongation Factor Tu , and ribosomal protein S1...	RF00023	L13	RF00555
SRP Signal recognition particle RNA The signal recognition particle RNA, also known as 7SL, 6S, , or 4.5S RNA, is the RNA component of the signal recognition particle ribonucleoprotein complex. SRP is a universally conserved ribonucleoprotein that directs the traffic of proteins within the cell and allows them to be secreted...	RF00169

External links

Rfam database

The source of this article is wikipedia, the free encyclopedia. The text of this article is licensed under the GFDL.