In
human geneticsHuman genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...
,
Haplogroup I is a Y-chromosome DNA haplogroup, a subgroup of
haplogroup IJIn human genetics, Haplogroup IJ is a human Y-chromosome DNA haplogroup.Haplogroup IJ is a descendant branch of Haplogroup IJK which in turn derives from the greater Haplogroup F. Descendants are Haplogroup I and Haplogroup J...
, itself a derivative of
Haplogroup IJKIn human genetics, Haplogroup IJK is a human Y-chromosome DNA haplogroup.Haplogroup IJK is a descendant branch of the macrohaplogroup F with haplogroup IJ and haplogroup K as its attested descendants....
.
Y-DNA Haplogroup I (the letter I, not the number 1) represents nearly one-fifth of the population of Europe. It can be found in most present-day European populations, with greatest density in
Bosnia and HerzegovinaBosnia and Herzegovina Bosnia and Herzegovina Bosnia and Herzegovina ( or (Bosnian, Croatian, Serbian Latin: Bosna i Hercegovina; Serbian Cyrillic: Босна и Херцеговина) is a country in Southeast Europe, on the Balkan Peninsula...
,
CroatiaCroatia , officially the Republic of Croatia , is a country in southeast Europe, at the crossroads of the Pannonian Plain, the Balkans, and the Mediterranean Sea. Its capital is Zagreb...
,
SwedenSweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe...
,
NorwayNorway , officially the Kingdom of Norway, is a country in Northern Europe occupying the western portion of the Scandinavian Peninsula, as well as Jan Mayen and the Arctic archipelago of Svalbard under the Spitsbergen Treaty...
, and
SardiniaSardinia is the second-largest island in the Mediterranean Sea . The area of Sardinia is . The nearest land masses to the island are the French island of Corsica, the Italian Peninsula, Tunisia, and the Spanish Balearic Islands...
(
ItalyItaly , officially the Italian Republic , is a country located on the Italian Peninsula in Southern Europe and on the two largest islands in the Mediterranean Sea, Sicily and Sardinia. Italy shares its northern, Alpine boundary with France, Switzerland, Austria and Slovenia...
). The haplogroup is almost non-existent outside of Europe, suggesting that it arose in Europe.
Origins
The TMRCA (time to
most recent common ancestorIn genetics, the most recent common ancestor of any set of organisms is the most recent individual from which all organisms in the group are directly descended...
) for the I
cladeA clade is a term used in modern alpha taxonomy, the scientific classification of living and fossil organisms, to describe a monophyletic group, defined as a group consisting of a single common ancestor and all its descendants.[The term "monophyletic group" is used in this article...]
, expressed in ky (confidence interval), is 22.2 (15.3-30.0), placing the Haplogroup I founding event approximately contemporaneous with the onset of the
last glacial maximumThe Last Glacial Maximum refers to the time of maximum extent of the ice sheets during the last glacial period, approximately 20,000 years ago. This extreme persisted for several thousand years. It is followed by the Late Glacial Maximum....
(LGM) approximately 21 thousand years ago. Some speculate the initial dispersion of this population corresponds to the diffusion of the
Gravettianthumb|right|Burins similar to these are characteristic diagnostic artifacts typical of the digs attributed to the Gravettian culture.The Gravettian toolmaking culture was a specific archaeological industry of the European Upper Palaeolithic era prevalent before the last glacial epoch...
culture.
Haplogroup I is closely related to
Haplogroup JIn human genetics, Haplogroup J is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.-Origins:...
, which is today most common in
SemiticIn linguistics and ethnology, Semitic was first used to refer to a language family of largely Middle Eastern origin, now called the Semitic languages....
and
Northeast CaucasianThe Northeast Caucasian languages, also called East Caucasian, Nakh'-Dag'estanian, or Caspian, constitute a language family spoken in the Russian republics of Dagestan, Chechnya, and Ingushetia, in northern Azerbaijan, and in Georgia, as well as in diaspora populations in Russia, Turkey, and the...
peoples; both Haplogroup I and Haplogroup J have mutations in common making them descendants of
Haplogroup IJ (S2, S22)In human genetics, Haplogroup IJ is a human Y-chromosome DNA haplogroup.Haplogroup IJ is a descendant branch of Haplogroup IJK which in turn derives from the greater Haplogroup F. Descendants are Haplogroup I and Haplogroup J...
. The divergence of Haplogroup IJ into its descendant lineages, Haplogroups I and J, however, occurred many thousands of years prior to the first attestations of
Semitic languagesThe Semitic languages are a group of related languages whose living representatives are spoken by more than 467 million people across much of the Middle East, North Africa and the Horn of Africa...
, peoples or cultures during the mid-third millennium B.C. Furthermore, the
Semitic languagesThe Semitic languages are a group of related languages whose living representatives are spoken by more than 467 million people across much of the Middle East, North Africa and the Horn of Africa...
, and the larger Afro-Asiatic languages of which they form a part, are most strongly associated with the M35 lineage of haplogroup E originating far from the
LevantThe Levant describes, traditionally, the Eastern Mediterranean at large, but can be used as a geographical term that denotes a large area in Western Asia formed by the lands bordering the eastern shores of the Mediterranean, roughly bounded on the north by the Taurus Mountains, on the south by...
in
AfricaAfrica is the world's second-largest and second most-populous continent, after Asia. At about 30.2 million km² including adjacent islands, it covers 6% of the Earth's total surface area and 20.4% of the total land area. With a billion people in 61 territories, it accounts for about 14.8% of the...
.
Note the TMRCA is an estimate of the time of subclade divergence. Rootsi et al. 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I, they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky. With these estimates, they are consistent with Karafet et al. 2008. A recent outlier is Underhill et al. 2007, which calculates the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky. This will need to be explained further, since they further calculate the STR variation age of I1 at only 8.1±1.5 ky.
Distribution
Rootsi et al. 2004 suggest that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the ice age.
Haplogroup I Y-chromosomes have also been found among some populations of the
Middle EastThe Middle East is a region that spans southwestern Asia, southeastern Europe, and northeastern Africa. It has no clear boundaries, often used as a synonym to Near East, in opposition to Far East...
, the Caucasus, and Central Asia, but they are found at frequencies exceeding 10% only among populations of Europe and Asia Minor, particularly among
GermanicThe Germanic peoples are a historical ethno-linguistic group, originating in Northern Europe and identified by their use of the Indo-European Germanic languages which diversified out of Common Germanic in the course of the Pre-Roman Iron Age...
,
SlavicThe Slavic Peoples are an ethnic and linguistic branch of Indo-European peoples, living mainly in eastern and central Europe. From the early 6th century they spread from their original homeland to inhabit most of eastern Central Europe, Eastern Europe and the Balkans...
, Uralic, and
Turkic peoplesThe Turkic peoples are Eurasian peoples residing in northern, central and western Eurasia. They speak languages belonging to the Turkic language family. They share, to varying degrees, certain cultural traits and historical backgrounds...
, as well as among the
RomanceThe Romance languages are a branch of the Indo-European language family comprising all the languages that descend from Latin, the language of ancient Rome...
-speaking populations of
FranceFrance , officially the French Republic , is a country located in Western Europe, with several overseas islands and territories located on other continents. Metropolitan France extends from the Mediterranean Sea to the English Channel and the North Sea, and from the Rhine to the Atlantic Ocean...
,
RomaniaRomania is a country located in Southeastern and Central Europe, North of the Balkan Peninsula, on the Lower Danube, within and outside the Carpathian arch, bordering on the Black Sea. Almost all of the Danube Delta is located within its territory...
,
MoldovaMoldova , officially the Republic of Moldova is a landlocked country in Eastern Europe, located between Romania to the west and Ukraine to the north, east and south....
, and
SardiniaSardinia is the second-largest island in the Mediterranean Sea . The area of Sardinia is . The nearest land masses to the island are the French island of Corsica, the Italian Peninsula, Tunisia, and the Spanish Balearic Islands...
, the
AlbanianAlbanian is a unique Indo-European language spoken by nearly 6 million people, primarily in Albania and Kosovo but also in other areas of the Balkans in which there is an Albanian population, including western Macedonia, Montenegro, and southern Serbia. Albanian is also spoken by native enclaves...
-speaking population of
AlbaniaAlbania , officially the Republic of Albania , is a Mediterranean country in South Eastern Europe. It is bordered by Montenegro to the north, Kosovo to the northeast, Macedonia to the east and Greece to the south-east...
, and the
GreekGreek , an independent branch of the Indo-European family of languages, is the language of the Greeks. Native to the southern Balkans, it has the longest documented history of any Indo-European language, spanning 34 centuries of written records. In its ancient form, it is the language of classical...
-speaking population of
GreeceGreece , officially the Hellenic Republic , is a country in southeastern Europe, situated on the southern end of the Balkan Peninsula....
.It is also found among Iranian population of
TehranTehran is the capital and largest city of Iran, and the administrative center of Tehran Province. Tehran is a sprawling city at the foot of the Tochal mountain range with an immense network of highways unparalleled in Western Asia...
and Isfahan (with frequency of 34% and 10% respectively).
http://www.eva.mpg.de/genetics/pdf/Caucasus_big_paper.pdf
Within Europe, several populations are distinguished by having a significantly
lower frequency of Haplogroup I than the surrounding populations: these depressions in the frequency of Haplogroup I distinguish the populations of
ItalyItaly , officially the Italian Republic , is a country located on the Italian Peninsula in Southern Europe and on the two largest islands in the Mediterranean Sea, Sicily and Sardinia. Italy shares its northern, Alpine boundary with France, Switzerland, Austria and Slovenia...
and
SwitzerlandSwitzerland , officially the Swiss Confederation , is a federal republic consisting of 26 states named cantons, with Bern as the seat of the federal authorities...
from
GermanyGermany , officially the Federal Republic of Germany , is a country in Central Europe. It is bordered to the north by the North Sea, Denmark, and the Baltic Sea; to the east by Poland and the Czech Republic; to the south by Austria and Switzerland; and to the west by France, Luxembourg, Belgium,...
and
SardiniaSardinia is the second-largest island in the Mediterranean Sea . The area of Sardinia is . The nearest land masses to the island are the French island of Corsica, the Italian Peninsula, Tunisia, and the Spanish Balearic Islands...
,
IberiaThe Iberian Peninsula, or Iberia, is located in the extreme southwest of Europe and includes modern-day Spain, Portugal, Andorra and Gibraltar and a very small area of France. It is the westernmost of the three major southern European peninsulas—the Iberian, Italian, and Balkan peninsulas...
from southern
FranceFrance , officially the French Republic , is a country located in Western Europe, with several overseas islands and territories located on other continents. Metropolitan France extends from the Mediterranean Sea to the English Channel and the North Sea, and from the Rhine to the Atlantic Ocean...
and
NormandyNormandy is a geographical region corresponding to the former Duchy of Normandy. It is situated along the English Channel coast of Northern France between Brittany and Picardy and comprises territory in northern France and the Channel Islands.Normandy is divided between French and British...
,
GreeceGreece , officially the Hellenic Republic , is a country in southeastern Europe, situated on the southern end of the Balkan Peninsula....
,
AlbaniaAlbania , officially the Republic of Albania , is a Mediterranean country in South Eastern Europe. It is bordered by Montenegro to the north, Kosovo to the northeast, Macedonia to the east and Greece to the south-east...
and the
Slavic peoplesThe Slavic Peoples are an ethnic and linguistic branch of Indo-European peoples, living mainly in eastern and central Europe. From the early 6th century they spread from their original homeland to inhabit most of eastern Central Europe, Eastern Europe and the Balkans...
, and the Baltic Latvians from the
FinnicFinnic peoples are a linguistic group speaking Finnic languages: Baltic Finns, who live near the Baltic Sea, Volga Finns, who live near the Volga River, the Permians, who live in north-central Russia...
EstoniansEstonians are a Finnic people closely related to the Finns and inhabiting, primarily, the country of Estonia. The Estonians speak a Finno-Ugric language, known as Estonian...
. In all these areas, Haplogroup I populations are small relative to the dominant haplogroups in Europe (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).
Studies
Y-DNA haplogroup I has been researched in connection with HIV and AIDS progression. The research resulted in the finding that haplogroup I in general, and no specific subclade, had accelerated progression (in Y haplogroup I individuals) from HIV to AIDS. Suppression therapy also had a diminished effect on such individuals.
Subgroups
The
subcladeIn genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....
s of Haplogroup I with their defining mutations:
- I-M170 (M170, M258, P19, P38, P212, U179)
- I1-M253
In human genetics, Haplogroup I1 is a Y chromosome haplogroup occurring at greatest frequency in Scandinavia, associated with the mutations identified as M253, M307, P30, and P40. These are known as single nucleotide polymorphisms . It is a subclade of Haplogroup I. Before a reclassification in...
(M253, M307, M450/S109, P30, P40, S62, S63, S64, S65, S66, S107, S108, S110, S111) Typical of populations of ScandinaviaScandinavia is a geographical region in northern Europe that includes, and is named after, the Scanian Province. It consists of the kingdoms of Norway, Sweden, and Denmark...
and Northwest Europe, with a moderate distribution throughout Eastern EuropeEastern Europe is a region lying in the Eastern part of Europe. The term is highly context-dependent and there are "almost as many definitions of Eastern Europe as there are scholars of the region"...
- I1a-M21 (M21)
- I1b-M227 (M227) Appears to be limited to a marginally low frequency of approximately 1% among Slavic
The Slavic Peoples are an ethnic and linguistic branch of Indo-European peoples, living mainly in eastern and central Europe. From the early 6th century they spread from their original homeland to inhabit most of eastern Central Europe, Eastern Europe and the Balkans...
and Uralic peoples of Eastern EuropeEastern Europe is a region lying in the Eastern part of Europe. The term is highly context-dependent and there are "almost as many definitions of Eastern Europe as there are scholars of the region"...
; also detected in a single LebaneseLebanon , officially the Republic of Lebanon
[Republic of Lebanon is the most common term used by Lebanese government agencies...]
man
- I1c-P259 (P259/M507)
- I1d-L22 (L22/S142)
- I1e-S79 (S79)
- I2-M438
In human genetics, Haplogroup I2 is a Y-chromosome haplogroup. Until 2008, it was known as Haplogroup I1b.-Subclades:Note: The systematic subclade names have changed several times in recent years, and they are likely to change again, as new markers are discovered which clarify the sequential...
(M438/P215/S31, L68)
- I2a-P37.2 (P37.2)
- I2a1-M26 (M26) Typical of the population of the so-called "archaic zone" of Sardinia
Sardinia is the second-largest island in the Mediterranean Sea . The area of Sardinia is . The nearest land masses to the island are the French island of Corsica, the Italian Peninsula, Tunisia, and the Spanish Balearic Islands...
; also found at low frequencies among populations of Southwest Europe, particularly in CastileA former kingdom, Castile gradually merged with its neighbors to become the Crown of Castile and later the Kingdom of Spain with the Crown of Aragon and the Crown of Navarre...
, BéarnBéarn is a former province of France, located in the Pyrenees mountains and in the plain at their feet, in southwest France. Along with the three Basque provinces of Soule, Lower Navarre, and Labourd, the principality of Bidache, as well as small parts of Gascony, it forms in the southwest the...
, and the Basque CountryThe Basque Country as a greater region is a European cultural region in the western Pyrenees that spans the border between France and Spain, on the Atlantic coast....
- I2a1a-M161 (M161) Very rare (1 in Puerto Rico)
- I2a2-M423 (M423) Typical of the Slavic speaking populations of the Balkans
The Balkans is a geopolitical and cultural region of southeastern Europe...
, especially the populations of Bosnia and HerzegovinaBosnia and Herzegovina Bosnia and Herzegovina Bosnia and Herzegovina ( or (Bosnian, Croatian, Serbian Latin: Bosna i Hercegovina; Serbian Cyrillic: Босна и Херцеговина) is a country in Southeast Europe, on the Balkan Peninsula...
and CroatiaCroatia , officially the Republic of Croatia , is a country in southeast Europe, at the crossroads of the Pannonian Plain, the Balkans, and the Mediterranean Sea. Its capital is Zagreb...
; also found with high frequency in MoldaviaMoldavia is a geographic and historical region and former principality in Eastern Europe, corresponding to the territory between the Eastern Carpathians and the Dniester river...
and RomaniaRomania is a country located in Southeastern and Central Europe, North of the Balkan Peninsula, on the Lower Danube, within and outside the Carpathian arch, bordering on the Black Sea. Almost all of the Danube Delta is located within its territory...
and high haplotype diversity values, but lower overall frequency, among the West Slavic populations of SlovakiaThe Slovak Republic is a landlocked country in Eastern Europe with a population of over five million and an area of about . Slovakia borders the Czech Republic and Austria to the west, Poland to the north, Ukraine to the east and Hungary to the south. The largest city is its capital, Bratislava...
and the Czech RepublicThe Czech Republic is a country in Central Europe that is sometimes considered to be Eastern European. The country borders Poland to the northeast, Germany to the west and northwest, Austria to the south and Slovakia to the east. The capital and largest city is Prague...
- I2a2a-P41.2 (P41.2/M359.2) Very rare (2 in Bosnia and Herzegovina, 1 in Turkey, 1 in England and 1 in Croatia)
- I2b-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32)
- I2b1-M223 (M223, P219/S24, P220/S119, P221/S120, P222/U250/S118, P223/S117) Occurs at a moderate frequency among populations of Northwest Europe, with a peak frequency in the region of Lower Saxony
Lower Saxony lies in north-western Germany and is second in area and fourth in population among the sixteen Bundesländer of Germany...
in central GermanyGermany , officially the Federal Republic of Germany , is a country in Central Europe. It is bordered to the north by the North Sea, Denmark, and the Baltic Sea; to the east by Poland and the Czech Republic; to the south by Austria and Switzerland; and to the west by France, Luxembourg, Belgium,...
; minor offshoots appear in MoldaviaMoldavia is a geographic and historical region and former principality in Eastern Europe, corresponding to the territory between the Eastern Carpathians and the Dniester river...
and RussiaRussia , officially known as both Russia and the Russian Federation , is a country in northern Eurasia . It is a semi-presidential republic, comprising 83 federal subjects...
(especially around VladimirVladimir Oblast is a federal subject of Russia . Its administrative center is the medieval Russian capital Vladimir, which is located 190 km to the east from the present-day capital, Moscow. For detailed information about the area's medieval history, see Zalesye and Vladimir-Suzdal...
, RyazanRyazan Oblast is a federal subject of Russia . It has an area of 39,600 km² and a population of 1,227,910...
, Nizhny NovgorodNizhni Novgorod Oblast is a federal subject of Russia . Its administrative center is the city of Nizhny Novgorod...
, and the Republic of MordoviaRepublic of Mordovia or Mordvinia is a federal subject of Russia . The direct romanization of the republic's name is Respublika Mordoviya....
)
- I2b1a-M284 (M284) Generally limited to a low frequency in Great Britain
Great Britain is an island lying to the northwest of Continental Europe. It is the ninth largest island in the world, and the largest European island. With a population of about 59.6 million people, it is the third most populated island on Earth. Great Britain is surrounded by over 1000 smaller...
- I2b1a1-L126 (L126/S165, L137/S166)
- I2b1b-M379 (M379)
- I2b1c-P78 (P78)
- I2b1d-P95 (P95)
- I2b2-L38 (L38/S154, L39/S155, L40/S156, L65/S159)
Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..
I-M170
The composite
subclade I contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.
Several haplogroup I-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of
TurkeyTurkey , known officially as the Republic of Turkey
, is a Eurasian country that stretches across the Anatolian peninsula in Western Asia and Thrace in the Balkan region of southeastern Europe...
(8/741),
AdygeaThe Republic of Adygea is a federal subject of Russia enclaved within Krasnodar Krai. Its size is 7,600 km² with a population of almost 450,000. Its capital is Maykop. The direct transliteration of the republic's name is Respublika Adygeya...
(2/138), and
IraqIraq , officially the Republic of Iraq , also known as Mesopotamia, is a country in Western Asia spanning most of the northwestern end of the Zagros mountain range, the eastern part of the Syrian Desert and the northern part of the Arabian Desert.Iraq shares borders with Jordan to the west, Syria...
(1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I-M170 appear to be found among the
AndalusiansThe Andalusians are the inhabitants of the southern region in Spain. They are generally not considered an ethnically distinct people because they lack two of the most important markers of distinctiveness: their own language and an awareness of a presumed common origin. Andalusian Spanish is said to...
(3/103),
FrenchFrench people can refer to:* The legal residents and citizens of France, regardless of ancestry. For a legal discussion, see French nationality law.* People whose ancestors lived in France or the area that later became France....
(4/179), Slovenians (2/55), and the Saami (1/35).
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1181996&rendertype=table&id=TB1
I-M253
Haplogroup I-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern
NorwayNorway , officially the Kingdom of Norway, is a country in Northern Europe occupying the western portion of the Scandinavian Peninsula, as well as Jan Mayen and the Arctic archipelago of Svalbard under the Spitsbergen Treaty...
, southwestern
SwedenSweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe...
, and
DenmarkDenmark is a Scandinavian country in Northern Europe and the senior member of the Kingdom of Denmark. It is the southernmost of the Nordic countries; southwest of Sweden and south of Norway, and it is bordered to the south by Germany. Denmark borders both the Baltic and the North Sea...
, and rapidly decreasing frequencies toward the edges of the historically
GermanicThe Germanic peoples are a historical ethno-linguistic group, originating in Northern Europe and identified by their use of the Indo-European Germanic languages which diversified out of Common Germanic in the course of the Pre-Roman Iron Age...
-influenced world. A notable exception is
FinlandFinland , officially the Republic of Finland
, is a Nordic country and democracy situated in the Fennoscandian region of northern Europe. It borders Sweden on the west, Russia on the east, and Norway on the north, while Estonia lies to its south across the Gulf of Finland...
, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.
Outside
FennoscandiaFennoscandia and Fenno-Scandinavia are geographic and geological terms used to describe the Scandinavian Peninsula, the Kola Peninsula, Karelia and Finland. Geologically, the term also alludes to the underlying Fennoscandian Shield of Norway, Sweden, Finland, and northern Denmark, which is the...
, distribution of Haplogroup I-M253 is closely correlated with that of Haplogroup I-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I-M253. Another characteristic of the Scandinavian I-M253 Y-chromosomes is their rather low
haplotypeThe term haplotype is a contraction of the term 'haploid genotype'. In genetics, a haplotype is a combination of alleles at multiple loci that are transmitted together on the same chromosome...
diversity (STR diversity): a greater variety of Haplogroup I-M253 Y-chromosomes has been found among the
FrenchFrench people can refer to:* The legal residents and citizens of France, regardless of ancestry. For a legal discussion, see French nationality law.* People whose ancestors lived in France or the area that later became France....
and
ItaliansThe Italian people are an ethnic group, in the sense of sharing a common Italian culture, descent, and speaking the Italian language as a mother tongue...
, despite the much lower overall frequency of Haplogroup I-M253 among the modern French and Italian populations.
I-M438
I-M423
Haplogroup I-M423 is the most frequent Y-chromosome Haplogroup I in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in
DalmatiaDalmatia , is a region on the eastern coast of the Adriatic Sea and is situated in modern Croatia. It spreads between the island of Rab in the northwest and the Bay of Kotor, in Montenegro, in the southeast...
(50-60%) and Bosnia-Herzegovina (up to 75%),especially in the Croat population of Bosnia and Herzegovina A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I-M423 is virtually absent in
FennoscandiaFennoscandia and Fenno-Scandinavia are geographic and geological terms used to describe the Scandinavian Peninsula, the Kola Peninsula, Karelia and Finland. Geologically, the term also alludes to the underlying Fennoscandian Shield of Norway, Sweden, Finland, and northern Denmark, which is the...
, Western and Southwestern Europe.
I-M26
Haplogroup I-M26 is notable for its strong presence in Sardinia. Haplogroup I comprises more than 40% of all patrilines among the Sardinians, and I-M26 is the predominant type of I among them. It has been found outside of Sardinia only at low frequencies in Southwest Europe, the
Czech RepublicThe Czech Republic is a country in Central Europe that is sometimes considered to be Eastern European. The country borders Poland to the northeast, Germany to the west and northwest, Austria to the south and Slovakia to the east. The capital and largest city is Prague...
, and the
Republic of MacedoniaMacedonia , officially the Republic of Macedonia , is a country in the central Balkan peninsula in southeastern Europe. It is one of the successor states of the former Yugoslavia, from which it declared independence in 1991...
.
Haplogroup I-M26 is practically absent east of
FranceFrance , officially the French Republic , is a country located in Western Europe, with several overseas islands and territories located on other continents. Metropolitan France extends from the Mediterranean Sea to the English Channel and the North Sea, and from the Rhine to the Atlantic Ocean...
and
ItalyItaly , officially the Italian Republic , is a country located on the Italian Peninsula in Southern Europe and on the two largest islands in the Mediterranean Sea, Sicily and Sardinia. Italy shares its northern, Alpine boundary with France, Switzerland, Austria and Slovenia...
, while it is found at low but significant frequencies outside of Sardinia in the
Balearic IslandsThe Balearic Islands are an archipelago in the western Mediterranean Sea, near the eastern coast of the Iberian Peninsula....
,
CastileA former kingdom, Castile gradually merged with its neighbors to become the Crown of Castile and later the Kingdom of Spain with the Crown of Aragon and the Crown of Navarre...
, the
Basque CountryThe Basque Country as a greater region is a European cultural region in the western Pyrenees that spans the border between France and Spain, on the Atlantic coast....
, the
PyreneesThe Pyrenees are a range of mountains in southwest Europe that form a natural border between France and Spain...
, southern and western France, and parts of the
MaghrebThe Maghreb , also rendered Maghrib , meaning "place of sunset" or "western" in Arabic, is a region in North Africa. The term is generally applied to all of Morocco, Algeria, and Tunisia, but in older Arabic usage pertained only to the area of the three countries between the high ranges of the...
in
North AfricaNorth Africa or Northern Africa is the northernmost region of the African continent, linked by the Sahara to Sub-Saharan Africa.Geopolitically, the UN definition of Northern Africa includes the following seven countries or territories; Algeria, Egypt, Libya, Morocco, Sudan, Tunisia,Mauritania, and...
,
Great BritainGreat Britain is an island lying to the northwest of Continental Europe. It is the ninth largest island in the world, and the largest European island. With a population of about 59.6 million people, it is the third most populated island on Earth. Great Britain is surrounded by over 1000 smaller...
, and
IrelandIreland is the third-largest island in Europe and the twentieth-largest island in the world. It lies to the north-west of continental Europe and is surrounded by hundreds of islands and islets. To the east of Ireland, separated by the Irish Sea, is the island of Great Britain...
. Haplogroup I-M26 appears to be the only subclade of Haplogroup I found among the
BasquesThe Basques are the native people of the Basque Country .The Basques as an ethnic group primarily inhabit an area traditionally known as the Basque Country, a region that is located around the western end of the Pyrenees on the coast of the Bay of Biscay and straddles parts of north-eastern Spain...
, but appears to be found at somewhat higher frequencies among the general populations of
CastileA former kingdom, Castile gradually merged with its neighbors to become the Crown of Castile and later the Kingdom of Spain with the Crown of Aragon and the Crown of Navarre...
in Spain and
BéarnBéarn is a former province of France, located in the Pyrenees mountains and in the plain at their feet, in southwest France. Along with the three Basque provinces of Soule, Lower Navarre, and Labourd, the principality of Bidache, as well as small parts of Gascony, it forms in the southwest the...
in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.
I-M436
The distribution of
Haplogroup I-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in
FennoscandiaFennoscandia and Fenno-Scandinavia are geographic and geological terms used to describe the Scandinavian Peninsula, the Kola Peninsula, Karelia and Finland. Geologically, the term also alludes to the underlying Fennoscandian Shield of Norway, Sweden, Finland, and northern Denmark, which is the...
, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I-M253; the lack of correlation between the distributions of I-M253 and I-M436 in Fennoscandia may be a result of Haplogroup I-M436's being more strongly affected in the earliest settlement of this region by
founder effectIn population genetics, the founder effect is the loss of genetic variation that occurs when a new population is established by a very small number of individuals from a larger population. It was first fully outlined by Ernst Mayr in 1952, using existing theoretical work by those such as Sewall...
s and
genetic driftGenetic drift or allelic drift is the change in the relative frequency with which a gene variant occurs in a population due to random sampling and chance: the alleles in offspring are a random sample of those in the parents, and chance has a role in determining whether a given individual survives...
due to its rarity, as Haplogroup I-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of
Lower SaxonyLower Saxony lies in north-western Germany and is second in area and fourth in population among the sixteen Bundesländer of Germany...
. Haplogroup I-M436 has been found in over 4% of the population only in
GermanyGermany , officially the Federal Republic of Germany , is a country in Central Europe. It is bordered to the north by the North Sea, Denmark, and the Baltic Sea; to the east by Poland and the Czech Republic; to the south by Austria and Switzerland; and to the west by France, Luxembourg, Belgium,...
, the
NetherlandsThe Netherlands is a country in Northwestern Europe, constituting the major portion of the Kingdom of the Netherlands. It is a parliamentary democratic constitutional monarchy. The Netherlands borders the North Sea to the north and west, Belgium to the south, and Germany to the east...
,
BelgiumThe Kingdom of Belgium is a country in northwest Europe. It is a founding member of the European Union and hosts its headquarters, as well as those of other major international organizations, including NATO...
,
DenmarkDenmark is a Scandinavian country in Northern Europe and the senior member of the Kingdom of Denmark. It is the southernmost of the Nordic countries; southwest of Sweden and south of Norway, and it is bordered to the south by Germany. Denmark borders both the Baltic and the North Sea...
,
EnglandEngland is a country that is part of the United Kingdom. It shares land borders with Scotland to the north and Wales to the west; the Irish Sea is to the north west, the Celtic Sea to the south west and the North Sea to the east, with the English Channel to the south separating it from continental...
(not including
CornwallCornwall is a county of England in the United Kingdom, forming the tip of the south-western peninsula of Great Britain. It is bordered to the north and west by the Atlantic Ocean, to the south by the English Channel, and to the east by the county of Devon, over the River Tamar. Taken with the...
),
ScotlandScotland is a country that is part of the United Kingdom. Occupying the northern third of the island of Great Britain, it shares a border with England to the south and is bounded by the North Sea to the east, the Atlantic Ocean to the north and west, and the North Channel and Irish Sea to the...
, and the southern tips of
SwedenSweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe...
and
NorwayNorway , officially the Kingdom of Norway, is a country in Northern Europe occupying the western portion of the Scandinavian Peninsula, as well as Jan Mayen and the Arctic archipelago of Svalbard under the Spitsbergen Treaty...
in Northwest Europe; the provinces of
NormandyNormandy is a geographical region corresponding to the former Duchy of Normandy. It is situated along the English Channel coast of Northern France between Brittany and Picardy and comprises territory in northern France and the Channel Islands.Normandy is divided between French and British...
,
MaineThe State of Maine is a state in the New England region of the northeastern United States, bordering the Atlantic Ocean to the southeast, New Hampshire to the southwest, and the Canadian provinces of Quebec to the northwest and New Brunswick to the northeast. Maine is the northernmost portion of...
,
AnjouAnjou is a former county , duchy and province centred on the city of Angers in the lower Loire Valley of western France. It corresponds largely to the present-day département of Maine-et-Loire...
, and
PerchePerche is a former province of northern France extending over the départements of Orne, Eure, Eure-et-Loir and Sarthe.-Geography:Perche is bounded by Normandy to the north and west, Maine to the south-west, Vendomois and Dunois to the south, Beauce to the east and Thimerais to the north-east.The...
in northwestern
FranceFrance , officially the French Republic , is a country located in Western Europe, with several overseas islands and territories located on other continents. Metropolitan France extends from the Mediterranean Sea to the English Channel and the North Sea, and from the Rhine to the Atlantic Ocean...
; the province of
ProvenceProvence is a region of southeastern France on the Mediterranean adjacent to Italy. It is part of the administrative région of Provence-Alpes-Côte d'Azur...
in southeastern France; the regions of
TuscanyTuscany is a region in North-Central Italy. It has an area of and a population of about 3.6 million inhabitants. The regional capital is Florence.Tuscany is known for its landscapes and its artistic legacy...
,
UmbriaUmbria is a region of central Italy. Its capital is Perugia. It has an area of 8,456 km² and about 900,000 inhabitants.- Geography :...
, and
LatiumLazio , is a region of central Italy, bordered by Tuscany, Umbria, and Marche to the north, Abruzzo to the east, Campania to the south, and the Tyrrhenian Sea to the west.- Geography :...
in
ItalyItaly , officially the Italian Republic , is a country located on the Italian Peninsula in Southern Europe and on the two largest islands in the Mediterranean Sea, Sicily and Sardinia. Italy shares its northern, Alpine boundary with France, Switzerland, Austria and Slovenia...
; and
MoldaviaMoldavia is a geographic and historical region and former principality in Eastern Europe, corresponding to the territory between the Eastern Carpathians and the Dniester river...
and the area around Russia's
Ryazan OblastRyazan Oblast is a federal subject of Russia . It has an area of 39,600 km² and a population of 1,227,910...
and
Republic of MordoviaRepublic of Mordovia or Mordvinia is a federal subject of Russia . The direct romanization of the republic's name is Respublika Mordoviya....
in Eastern Europe. One subclade of Haplogroup I-M436, namely I-M284, has been found almost exclusively among the population of
Great BritainGreat Britain is an island lying to the northwest of Continental Europe. It is the ninth largest island in the world, and the largest European island. With a population of about 59.6 million people, it is the third most populated island on Earth. Great Britain is surrounded by over 1000 smaller...
, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I-M253 and Haplogroup I-M436 seem to correlate fairly well with the extent of historical influence of
Germanic peoplesThe Germanic peoples are a historical ethno-linguistic group, originating in Northern Europe and identified by their use of the Indo-European Germanic languages which diversified out of Common Germanic in the course of the Pre-Roman Iron Age...
, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of
BithyniaBithynia was an ancient region, kingdom and Roman province in the northwest of Asia Minor, adjoining the Propontis, the Thracian Bosporus and the Euxine .-Description:...
and
GalatiaAncient Galatia was an area in the highlands of central Anatolia in modern Turkey. Galatia, an ancient region of Asia Minor, was named for the immigrant Gauls from Thrace , who settled here and became its ruling caste in the 3rd century BC...
in
TurkeyTurkey , known officially as the Republic of Turkey
, is a Eurasian country that stretches across the Anatolian peninsula in Western Asia and Thrace in the Balkan region of southeastern Europe...
rather suggests a connection with the ancient
GaulsThe Gauls were a Celtic people living in Gaul, the region roughly corresponding to what is now France and Belgium, from the Iron Age through the Roman period. They spoke the Continental Celtic language called Gaulish....
of
ThraceThrace is a historical and geographic area in southeast Europe. As a geographical concept, Thrace designates a region bounded on the north by the Balkan Mountains, on the south by the Rhodope Mountains and the Aegean Sea and on the east by the Black Sea and the Sea of Marmara...
, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of
Nicomedes I of BithyniaNicomedes I , second king of Bithynia, was the eldest son of Zipoites, whom he succeeded on the throne in 278 BC.-Overview:...
.
Haplogroup I-M436 also occurs among approximately 1% of Sardinians.
Specifications of mutation
The technical details of U179 are:
- Nucleotide change (rs2319818): G to A
- Position (base pair): 275
- Total size (base pairs): 220
- Forward 5′→ 3′: aaggggatatgacgactgatt
- Reverse 5′→ 3′: cagctcctcttttcaactctca
Testing Strategy
For Haplogroup I,
STRSTR, Str or str may stand for:*Short tandem repeat, in DNA testing*Special Theory of Relativity, Einstein's theory*String , in computing...
testing, with at least 25 and preferably 40 or more
alleleAn allele is one of a series of different forms of a gene. The word is a short form of allelomorph , which was used in the early days of genetics to describe variant forms of a gene detected as different phenotypes...
s tested, will allow accurate inference of all currently known Haplogroup I subclade
single nucleotide polymorphismA single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide — A, T, C, or G — in the genome differs between members of a species...
s (SNP). It will also provide necessary resolution to help with identifying close relatives in family history time frames. Once the
STRSTR, Str or str may stand for:*Short tandem repeat, in DNA testing*Special Theory of Relativity, Einstein's theory*String , in computing...
testing results are available, one should ensure they are posted in a public database for genealogy search as well as research purposes. Then, if the lab indicates you are Haplogroup I, compare the returned
STRSTR, Str or str may stand for:*Short tandem repeat, in DNA testing*Special Theory of Relativity, Einstein's theory*String , in computing...
values to an existing table of compiled Haplogroup I
haplotypeThe term haplotype is a contraction of the term 'haploid genotype'. In genetics, a haplotype is a combination of alleles at multiple loci that are transmitted together on the same chromosome...
s to determine your specific haplotype (
go to http://www.isogg.org/tree/ISOGG_HapgrpI08.html and under Additional Resources, select the link to Modal Haplotypes for Y-Haplogroup I Varieties, then download FounderHaps.xls). Note that FTDNA values for your
STRSTR, Str or str may stand for:*Short tandem repeat, in DNA testing*Special Theory of Relativity, Einstein's theory*String , in computing...
alleles should be used when comparing to this table. Note also that the previous version of subclade names are used.
At this stage of Haplogroup I research, there is more resolution of sub-groups available through matching
STRSTR, Str or str may stand for:*Short tandem repeat, in DNA testing*Special Theory of Relativity, Einstein's theory*String , in computing...
alleleAn allele is one of a series of different forms of a gene. The word is a short form of allelomorph , which was used in the early days of genetics to describe variant forms of a gene detected as different phenotypes...
s with the listed
haplotypeThe term haplotype is a contraction of the term 'haploid genotype'. In genetics, a haplotype is a combination of alleles at multiple loci that are transmitted together on the same chromosome...
s than is available via testing for known subclade SNPs. This has been the situation for a few years now, but hopefully may change when more people undergo SNP testing for some of the newer SNPs that are being discovered.
Phylogenetic tree and distribution maps
Mailing Lists
Projects
Other